<?xml version="1.0" encoding="UTF-8"?>
<!DOCTYPE article PUBLIC "-//NLM//DTD Journal Publishing with OASIS Tables v3.0 20080202//EN" "journalpub-oasis3.dtd">
<article xmlns:xlink="http://www.w3.org/1999/xlink" xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:oasis="http://docs.oasis-open.org/ns/oasis-exchange/table" xml:lang="en" dtd-version="3.0" article-type="research-article"><?xmltex \bartext{Research article}?>
  <front>
    <journal-meta><journal-id journal-id-type="publisher">BG</journal-id><journal-title-group>
    <journal-title>Biogeosciences</journal-title>
    <abbrev-journal-title abbrev-type="publisher">BG</abbrev-journal-title><abbrev-journal-title abbrev-type="nlm-ta">Biogeosciences</abbrev-journal-title>
  </journal-title-group><issn pub-type="epub">1726-4189</issn><publisher>
    <publisher-name>Copernicus Publications</publisher-name>
    <publisher-loc>Göttingen, Germany</publisher-loc>
  </publisher></journal-meta>
    <article-meta>
      <article-id pub-id-type="doi">10.5194/bg-20-1277-2023</article-id><title-group><article-title>Ecological divergence of a mesocosm in an eastern boundary<?xmltex \hack{\break}?> upwelling system
assessed with multi-marker<?xmltex \hack{\break}?> environmental DNA metabarcoding</article-title><alt-title>Ecological divergence of a mesocosm</alt-title>
      </title-group><?xmltex \runningtitle{Ecological divergence of a mesocosm}?><?xmltex \runningauthor{M.~A.~Min et al.}?>
      <contrib-group>
        <contrib contrib-type="author" corresp="no" rid="aff1 aff2">
          <name><surname>Min</surname><given-names>Markus A.</given-names></name>
          
        <ext-link>https://orcid.org/0000-0002-5032-0681</ext-link></contrib>
        <contrib contrib-type="author" corresp="no" rid="aff1 aff3">
          <name><surname>Needham</surname><given-names>David M.</given-names></name>
          
        </contrib>
        <contrib contrib-type="author" corresp="no" rid="aff1">
          <name><surname>Sudek</surname><given-names>Sebastian</given-names></name>
          
        </contrib>
        <contrib contrib-type="author" corresp="no" rid="aff1">
          <name><surname>Truelove</surname><given-names>Nathan Kobun</given-names></name>
          
        </contrib>
        <contrib contrib-type="author" corresp="no" rid="aff1">
          <name><surname>Pitz</surname><given-names>Kathleen J.</given-names></name>
          
        <ext-link>https://orcid.org/0000-0002-4931-8592</ext-link></contrib>
        <contrib contrib-type="author" corresp="no" rid="aff1 aff3">
          <name><surname>Chavez</surname><given-names>Gabriela M.</given-names></name>
          
        </contrib>
        <contrib contrib-type="author" corresp="no" rid="aff1 aff3">
          <name><surname>Poirier</surname><given-names>Camille</given-names></name>
          
        </contrib>
        <contrib contrib-type="author" corresp="no" rid="aff1 aff3">
          <name><surname>Gardeler</surname><given-names>Bente</given-names></name>
          
        </contrib>
        <contrib contrib-type="author" corresp="no" rid="aff4">
          <name><surname>von der Esch</surname><given-names>Elisabeth</given-names></name>
          
        </contrib>
        <contrib contrib-type="author" corresp="no" rid="aff3">
          <name><surname>Ludwig</surname><given-names>Andrea</given-names></name>
          
        </contrib>
        <contrib contrib-type="author" corresp="no" rid="aff3">
          <name><surname>Riebesell</surname><given-names>Ulf</given-names></name>
          
        <ext-link>https://orcid.org/0000-0002-9442-452X</ext-link></contrib>
        <contrib contrib-type="author" corresp="no" rid="aff1 aff3">
          <name><surname>Worden</surname><given-names>Alexandra Z.</given-names></name>
          
        </contrib>
        <contrib contrib-type="author" corresp="yes" rid="aff1">
          <name><surname>Chavez</surname><given-names>Francisco P.</given-names></name>
          <email>chfr@mbari.org</email>
        </contrib>
        <aff id="aff1"><label>1</label><institution>Monterey Bay Aquarium Research Institute, Moss Landing, CA, USA</institution>
        </aff>
        <aff id="aff2"><label>2</label><institution>School of Aquatic and Fishery Sciences, University of Washington, Seattle, WA, USA</institution>
        </aff>
        <aff id="aff3"><label>3</label><institution>GEOMAR Helmholtz Centre for Ocean Research Kiel, Kiel, Germany</institution>
        </aff>
        <aff id="aff4"><label>4</label><institution>Institute of Hydrochemistry, Technical University of Munich, Munich, Germany</institution>
        </aff>
      </contrib-group>
      <author-notes><corresp id="corr1">Francisco P. Chavez (chfr@mbari.org)</corresp></author-notes><pub-date><day>5</day><month>April</month><year>2023</year></pub-date>
      
      <volume>20</volume>
      <issue>7</issue>
      <fpage>1277</fpage><lpage>1298</lpage>
      <history>
        <date date-type="received"><day>27</day><month>October</month><year>2022</year></date>
           <date date-type="rev-request"><day>10</day><month>November</month><year>2022</year></date>
           <date date-type="rev-recd"><day>2</day><month>March</month><year>2023</year></date>
           <date date-type="accepted"><day>2</day><month>March</month><year>2023</year></date>
      </history>
      <permissions>
        <copyright-statement>Copyright: © 2023 </copyright-statement>
        <copyright-year>2023</copyright-year>
      <license license-type="open-access"><license-p>This work is licensed under the Creative Commons Attribution 4.0 International License. To view a copy of this licence, visit <ext-link ext-link-type="uri" xlink:href="https://creativecommons.org/licenses/by/4.0/">https://creativecommons.org/licenses/by/4.0/</ext-link></license-p></license></permissions><self-uri xlink:href="https://bg.copernicus.org/articles/.html">This article is available from https://bg.copernicus.org/articles/.html</self-uri><self-uri xlink:href="https://bg.copernicus.org/articles/.pdf">The full text article is available as a PDF file from https://bg.copernicus.org/articles/.pdf</self-uri>
      <abstract><title>Abstract</title>

      <p id="d1e216">Eastern boundary upwelling systems (EBUS) contribute a disproportionate
fraction of the global fish catch relative to their size and are especially
susceptible to global environmental change. Here we present the evolution of
communities over 50 d in an in situ mesocosm 6 km offshore of Callao, Peru, and
in the nearby unenclosed coastal Pacific Ocean. The communities were
monitored using multi-marker environmental DNA (eDNA) metabarcoding and flow
cytometry. DNA extracted from weekly water samples were subjected to
amplicon sequencing for four genetic loci: (1) the V1–V2 region of the 16S
rRNA gene for photosynthetic eukaryotes (via their chloroplasts) and
bacteria; (2) the V9 region of the 18S rRNA gene for exploration of
eukaryotes but targeting phytoplankton; (3) cytochrome oxidase I (COI) for
exploration of eukaryotic taxa but targeting invertebrates; and (4) the 12S
rRNA gene, targeting vertebrates. The multi-marker approach showed a
divergence of communities (from microbes to fish) between the mesocosm and
the unenclosed ocean. Together with the environmental information, the
genetic data furthered our mechanistic understanding of the processes that
are shaping EBUS communities in a changing ocean. The unenclosed ocean
experienced significant variability over the course of the 50 d experiment,
with temporal shifts in community composition, but remained dominated by
organisms that are characteristic of high-nutrient upwelling conditions
(e.g., diatoms, copepods, anchovies). A large directional change was found in
the mesocosm community. The mesocosm community that developed was
characteristic of upwelling regions when upwelling relaxes and waters
stratify (e.g., dinoflagellates, nanoflagellates). The selection of
dinoflagellates under the salinity-driven experimentally stratified
conditions in the mesocosm, as well as the warm conditions brought about by
the coastal El Niño, may be an indication of how EBUS will respond under
the global environmental changes (i.e., increases in surface temperature and
freshwater input, leading to increased stratification) forecast by the IPCC.</p>
  </abstract>
    
<funding-group>
<award-group id="gs1">
<funding-source>Gordon and Betty Moore Foundation</funding-source>
<award-id>GBMF 3788</award-id>
</award-group>
<award-group id="gs2">
<funding-source>National Aeronautics and Space Administration</funding-source>
<award-id>NNX14AP62A</award-id>
</award-group>
<award-group id="gs3">
<funding-source>National Science Foundation</funding-source>
<award-id>NSF DEB-1639033</award-id>
</award-group>
</funding-group>
</article-meta>
  </front>
<body>
      

<sec id="Ch1.S1" sec-type="intro">
  <label>1</label><title>Introduction</title>
      <p id="d1e228">Eastern boundary upwelling systems (EBUS) are exceptionally productive
marine ecosystems: they account for 5 % of total global primary production
(Carr, 2001) and 20 % of
marine fish production (Chavez
and Messié, 2009), while occupying less than 1 % of the area of the
ocean. Strong physical forcing drives productivity in these ecosystems;
upwelling-favorable winds bring macro- and micronutrients from depth to the
surface. Under favorable temperature and light conditions, phytoplankton
bloom (Messié and
Chavez, 2015), leading to increases in biomass in higher trophic levels
(Chavez
and Messié, 2009; Ayón et al., 2008). However,<?pagebreak page1278?> these systems are
variable both physically and ecologically, making it difficult to develop
mechanistic understanding of the links between ecological, biogeochemical,
and physical processes. Given that these systems may be disproportionately
affected by climate change (Gruber,
2011) it is key that we develop a predictive understanding of how these
systems will change over time. Here we present results from a perturbation
experiment geared at targeting this problem.</p>
      <p id="d1e231">Observational studies provide insights into processes regulating biological
production and community structure in upwelling systems, but because of the
complex interplay of multiple factors, it is difficult to assess the
relative contributions of drivers causing change. The EBUS literature has
extensive analyses of correlative relationships in the pursuit of causative
understanding
(e.g.,
Carr and Kearns, 2003; Messié and Chavez, 2015; Patti et al., 2008). By
isolating natural communities in enclosures or mesocosms, one can physically
perturb the system in a controlled manner
(Stewart
et al., 2013; Riebesell et al., 2008; Riemann et al., 2000; Sandaa et al.,
2009), providing a method for studying mechanisms driving responses of these
systems to perturbations. However, contained mesocosms remove horizontal
mixing processes, can modify vertical mixing, and remove top predators (fish
and mammals) and thus are not exact analogues of natural marine ecosystems.</p>
      <p id="d1e234">Variations in zooplankton, phytoplankton, and/or bacteria have been
monitored in mesocosm experiments using a variety of sampling techniques,
including nets of various mesh size, direct counts of bacteria from water
samples, flow cytometry for enumeration of small phytoplankton and bacteria,
or algal pigment analysis
(e.g.,
Hitchcock et al., 2016; Suffrian et al., 2008). Environmental DNA (eDNA)
metabarcoding is a complementary, rapidly evolving biomonitoring technique
that can survey these communities by examining both extracellular and
intracellular DNA present in environmental samples (Taberlet et
al., 2012). Here we define eDNA as any DNA captured by filtering seawater
through a low-porosity filter (Chavez et al., 2021), and as such it includes
intact microbial cells and other small live organisms as well as material
shed or produced by larger plants and animals that has not yet degraded. By
targeting and amplifying a highly variable region of the genome across
numerous taxonomic groups, eDNA metabarcoding allows for the simultaneous
detection and identification of a diversity of taxa
(Valentini et al., 2016) and has
been used in a variety of aquatic settings and across a wide range of
organisms, recovering greater alpha diversity than visual counts or
morphological identification
(Djurhuus et
al., 2018; Boussarie et al., 2018). While eDNA metabarcoding has been used
in mesocosms to demonstrate its effectiveness by detecting and identifying
known species assemblages
(Kelly et al.,
2014; Evans et al., 2016), its utility to detect change across multiple
trophic levels has not been demonstrated in perturbation mesocosm
experiments, nor have multiple eDNA markers been used simultaneously to
monitor community dynamics. By providing information about broad taxonomic
groups, eDNA metabarcoding provides a holistic, community-level view of
ecological changes occurring within mesocosms.</p>
      <p id="d1e237">Here, we present results from an in situ mesocosm experiment that took place in
austral summer 2017 in the coastal Peruvian upwelling system near Callao
(Bach et al., 2020). The broad
goals of the experiment (detailed in Bach et al., 2020) were to study how
marine populations and biogeochemical properties change during an upwelling
event; nutrient-rich water collected in the regional oxygen minimum zone
(OMZ) was added to the mesocosms. The mesocosms were later modified by the
injection of a salt brine solution to maintain the vertical density gradient
and prevent full water column mixing. This resulted in heavily stratified
mesocosms. A third, unintended perturbation occurred when seabirds began to
hover over and perch on the mesocosms during the last month, further
modifying biogeochemical and ecological conditions. Alongside the core
physicochemical measurements to characterize environmental conditions (Bach
et al., 2020), there were multiple ancillary experiments. Our team collected
samples for flow cytometry and eDNA from surface waters of the nearby
unenclosed Pacific Ocean and from a mesocosm over the 50 d experiment
period. Four genetic loci – the V1–V2 region of the 16S rRNA gene
(Sudek et al.,
2015; Giovannoni et al., 1990), the V9 region of the 18S rRNA gene
(Amaral-Zettler
et al., 2009; Stoeck et al., 2010; Amaral-Zettler et al., 2018),
mitochondrial cytochrome oxidase I (COI)
(Leray et al., 2013;
Folmer et al., 1994), and the mitochondrial 12S rRNA gene (Miya
et al., 2015) – were evaluated, capturing a diversity of bacterial,
phytoplankton, zooplankton, and vertebrate populations, respectively.</p>
      <p id="d1e241">Using this multi-marker approach, we detected the ecological divergence of
the mesocosm relative to the nearby highly variable and dynamic unenclosed
ocean. The mesocosm communities evolved to be dominated by taxa typical of
stratified conditions, whereas the unenclosed ocean retained a community
shaped by high nutrients and intermittent upwelling. The impact of resting
seabirds was detected via an “orni-eutrophication” driven phytoplankton
bloom (Bach et al., 2020) and the
appearance of DNA of fish, seabirds, and bacteria typical of
host-association of animal microbiomes (Saccharibacteria)
(Jaffe et al., 2021). This study
reveals a clear community shift driven by an experimental manipulation that
simulated upwelling and subsequent stratification, as well as the impact of
external inputs to the experimental system, and demonstrates that eDNA
metabarcoding is a powerful tool for detecting community-level changes over
time.</p>
</sec>
<?pagebreak page1279?><sec id="Ch1.S2">
  <label>2</label><title>Materials and methods</title>
<sec id="Ch1.S2.SS1">
  <label>2.1</label><title>Mesocosm deployment and manipulations</title>
      <p id="d1e259">On 22 February 2017, eight “Kiel Off-Shore Mesocosms for Ocean
Simulations” (KOSMOS)
(Riebesell
et al., 2013) were deployed just north of Isla San Lorenzo, 6 km off the
Peruvian coastline (Fig. 1). Each mesocosm consisted of a cylindrical 18.7 m
long polyurethane bag (2 m diameter, 54.4 <inline-formula><mml:math id="M1" display="inline"><mml:mo>±</mml:mo></mml:math></inline-formula> 1.3 m<inline-formula><mml:math id="M2" display="inline"><mml:msup><mml:mi/><mml:mn mathvariant="normal">3</mml:mn></mml:msup></mml:math></inline-formula> volume)
suspended in an 8 m tall flotation frame
(Bach et al., 2020). After
allowing water exchange for 3 d through nets (mesh size 3 mm) at the
top and bottom of each mesocosm, the water mass inside each of the mesocosms
was isolated from the surrounding water by attaching a conical sediment trap
to the lower end of the bags and pulling the upper ends of the bags
<inline-formula><mml:math id="M3" display="inline"><mml:mo>∼</mml:mo></mml:math></inline-formula> 1.5 m above the surface. The enclosing of the mesocosms
marked the start (day 0) of the 50 d experiment. Sampling of chl <inline-formula><mml:math id="M4" display="inline"><mml:mi>a</mml:mi></mml:math></inline-formula> and
physicochemical and biogeochemical conditions was performed on all eight
mesocosms as well as in the nearby coastal ocean within a few meters of
the mesocosms. The eDNA and flow cytometry samples were collected from all
mesocosms, but due to limited resources, the samples that were analyzed were
only from mesocosm M1 and the nearby unenclosed coastal Pacific Ocean, where
samples were taken within a few meters of the mesocosm frame. These two
collections and their analysis are referred to as mesocosm and Pacific
hereafter.</p>

      <?xmltex \floatpos{t}?><fig id="Ch1.F1"><?xmltex \currentcnt{1}?><?xmltex \def\figurename{Figure}?><label>Figure 1</label><caption><p id="d1e294">The KOSMOS 2017 study site. The eight mesocosms (M1–M8) were
deployed 6 km offshore of La Punta (Callao), just north of Isla San Lorenzo
(12.0555<inline-formula><mml:math id="M5" display="inline"><mml:msup><mml:mi/><mml:mo>∘</mml:mo></mml:msup></mml:math></inline-formula> S; 77.2348<inline-formula><mml:math id="M6" display="inline"><mml:msup><mml:mi/><mml:mo>∘</mml:mo></mml:msup></mml:math></inline-formula> W). All mesocosms were sampled for
chl <inline-formula><mml:math id="M7" display="inline"><mml:mi>a</mml:mi></mml:math></inline-formula>, various biogeochemical variables, and multiple physicochemical
parameters (Bach et al., 2020).
Mesocosm M1 (highlighted in red) was also analyzed for DNA and flow
cytometry, as was the nearby unenclosed Pacific Ocean. Please note that the
square marking the study site is not true to scale.</p></caption>
          <?xmltex \igopts{width=199.169291pt}?><graphic xlink:href="https://bg.copernicus.org/articles/20/1277/2023/bg-20-1277-2023-f01.png"/>

        </fig>

      <p id="d1e328">Over the course of the experiment, three primary intentional manipulations
took place in all eight mesocosms: OMZ water addition, salt additions to control
stratification, and additions of organisms. On days 11 and 12 of the
experiment, a total of <inline-formula><mml:math id="M8" display="inline"><mml:mo>∼</mml:mo></mml:math></inline-formula> 20 m<inline-formula><mml:math id="M9" display="inline"><mml:msup><mml:mi/><mml:mn mathvariant="normal">3</mml:mn></mml:msup></mml:math></inline-formula> of OMZ water collected at
a depth of 30 m was exchanged with the water enclosed in M1; this water had
been collected on day 5 from the OMZ located at station 1
(12.028323<inline-formula><mml:math id="M10" display="inline"><mml:msup><mml:mi/><mml:mo>∘</mml:mo></mml:msup></mml:math></inline-formula> S; 77.223603<inline-formula><mml:math id="M11" display="inline"><mml:msup><mml:mi/><mml:mo>∘</mml:mo></mml:msup></mml:math></inline-formula> W) of the IMARPE (Instituto
del Mar del Perú) time-series transect
(Graco et al., 2017) using deep water
collectors (Taucher et al., 2017).
The OMZ water was injected to a depth of 14–17 m and was designed to
simulate upwelling of water from the OMZ. In order to keep the mesocosm
stratified and thus preserve the low O<inline-formula><mml:math id="M12" display="inline"><mml:msub><mml:mi/><mml:mn mathvariant="normal">2</mml:mn></mml:msub></mml:math></inline-formula> bottom layer from the injected
OMZ water, a NaCl brine solution was injected evenly into the bottom layers
of the mesocosm on days 13 (69 L at a depth range of 10–17 m) and 33 (46 L at a depth range of 12.5–17 m) of the experiment. Some of the research
questions from this campaign concerned the responses of endemic organisms to
the experimental conditions in the mesocosms, and therefore two endemic
organisms, larvae of the Peruvian scallop (<italic>Argopecten purpuratus</italic>) and eggs of the fine flounder
(<italic>Paralichthys adspersus</italic>) were added to all mesocosms. On day 14, Peruvian scallop larvae was added
in concentrations of <inline-formula><mml:math id="M13" display="inline"><mml:mo>∼</mml:mo></mml:math></inline-formula> 10 000 individuals m<inline-formula><mml:math id="M14" display="inline"><mml:msup><mml:mi/><mml:mrow><mml:mo>-</mml:mo><mml:mn mathvariant="normal">3</mml:mn></mml:mrow></mml:msup></mml:math></inline-formula>, and on day 31 fine flounder eggs were added in concentrations of <inline-formula><mml:math id="M15" display="inline"><mml:mo>∼</mml:mo></mml:math></inline-formula> 90 individuals m<inline-formula><mml:math id="M16" display="inline"><mml:msup><mml:mi/><mml:mrow><mml:mo>-</mml:mo><mml:mn mathvariant="normal">3</mml:mn></mml:mrow></mml:msup></mml:math></inline-formula>. However, few scallop larvae and no fish larvae were
detected during subsequent sampling via vertical tows of an Apstein net of
mesh size 100 <inline-formula><mml:math id="M17" display="inline"><mml:mrow class="unit"><mml:mi mathvariant="normal">µ</mml:mi></mml:mrow></mml:math></inline-formula>m (unpublished data), and fine flounder DNA was only
detected in the two samples directly following the addition, indicating that
they either degraded or sank out of the surface layer.</p>
</sec>
<sec id="Ch1.S2.SS2">
  <label>2.2</label><title>Sample collection</title>
      <p id="d1e436">Salinity, temperature, and chl <inline-formula><mml:math id="M18" display="inline"><mml:mi>a</mml:mi></mml:math></inline-formula> fluorescence were measured with vertical
casts of a CTD60M sensor system (Sea and Sun Technologies) in all mesocosms
and the Pacific. Samples for inorganic nutrients were collected using a 5 L
“integrating water sampler” (IWS) (Hydro-Bios Kiel) that evenly collected
water for two separate depth ranges, the surface and bottom waters. However,
the inorganic nutrient, chl <inline-formula><mml:math id="M19" display="inline"><mml:mi>a</mml:mi></mml:math></inline-formula>, temperature, and salinity results presented
in the first column of Fig. 2 were calculated by averaging the
IWS-collected data over the two depth ranges. After transport back to an
onshore laboratory, nutrient samples were filtered (0.45 <inline-formula><mml:math id="M20" display="inline"><mml:mrow class="unit"><mml:mi mathvariant="normal">µ</mml:mi></mml:mrow></mml:math></inline-formula>m<?pagebreak page1280?> filter,
Sterivex, Merck) and analyzed using an autosampler (XY2 autosampler, SEAL
Analytical) and a continuous flow analyzer (QuAAtro AutoAnalyzer, SEAL
Analytical) connected to a fluorescence detector (FP-2020, JASCO). Silicic
acid (Si(OH)<inline-formula><mml:math id="M21" display="inline"><mml:msub><mml:mi/><mml:mn mathvariant="normal">4</mml:mn></mml:msub></mml:math></inline-formula>) was analyzed colorimetrically following the procedures
by  Mullin and Riley (1955). Nitrate
(NO<inline-formula><mml:math id="M22" display="inline"><mml:mrow><mml:msubsup><mml:mi/><mml:mn mathvariant="normal">3</mml:mn><mml:mo>-</mml:mo></mml:msubsup></mml:mrow></mml:math></inline-formula>) and nitrite (NO<inline-formula><mml:math id="M23" display="inline"><mml:mrow><mml:msubsup><mml:mi/><mml:mn mathvariant="normal">2</mml:mn><mml:mo>-</mml:mo></mml:msubsup></mml:mrow></mml:math></inline-formula>) were quantified through the
formation of a pink azo dye as established by
Morris and Riley (1963). Note that other
measurements were made throughout the experiment from all mesocosms as
reported elsewhere (Bach et al.,
2020). CTD (conductivity, temperature, and depth) casts and IWS water collections occurred every other day (except
for days 1–4 and 12–18, when they were taken daily).</p>

      <?xmltex \floatpos{t}?><fig id="Ch1.F2" specific-use="star"><?xmltex \currentcnt{2}?><?xmltex \def\figurename{Figure}?><label>Figure 2</label><caption><p id="d1e497">Physicochemical conditions, inorganic nutrients, and chlorophyll <inline-formula><mml:math id="M24" display="inline"><mml:mi>a</mml:mi></mml:math></inline-formula>
(chl <inline-formula><mml:math id="M25" display="inline"><mml:mi>a</mml:mi></mml:math></inline-formula>) in the mesocosms and unenclosed Pacific surface waters <bold>(a–e)</bold>, with
values averaged over the 0–17 m depth range. Flow cytometry results <bold>(f–j)</bold>
from samples collected in the surface waters; these depths were 0–5 m on
days 1 and 2, 0–10 m from day 3 to 28, and 0–12.5 m from day 29 to 50.
For all panels, each individual sample is indicated. For <bold>(a)</bold>, <bold>(b)</bold>, <bold>(c)</bold>, <bold>(d)</bold>,
and <bold>(e)</bold>, the solid grey line represents the mean for all eight mesocosms;
the shaded grey line is the mean <inline-formula><mml:math id="M26" display="inline"><mml:mo>±</mml:mo></mml:math></inline-formula> SE for all eight mesocosms. The
green lines indicate exchange of <inline-formula><mml:math id="M27" display="inline"><mml:mo>∼</mml:mo></mml:math></inline-formula> 20 m<inline-formula><mml:math id="M28" display="inline"><mml:msup><mml:mi/><mml:mn mathvariant="normal">3</mml:mn></mml:msup></mml:math></inline-formula> of OMZ water
with water in the mesocosm (total volume <inline-formula><mml:math id="M29" display="inline"><mml:mo>∼</mml:mo></mml:math></inline-formula> 50 m<inline-formula><mml:math id="M30" display="inline"><mml:msup><mml:mi/><mml:mn mathvariant="normal">3</mml:mn></mml:msup></mml:math></inline-formula>) on days 11 and 12. The orange lines indicate NaCl brine additions on days 13 (69 L
at a depth range of 10–17 m) and 33 (46 L at a depth range of 12.5–17 m). <bold>(a)</bold> Temperature. <bold>(b)</bold> Salinity. <bold>(c)</bold> NO<inline-formula><mml:math id="M31" display="inline"><mml:mrow><mml:msubsup><mml:mi/><mml:mn mathvariant="normal">2</mml:mn><mml:mo>-</mml:mo></mml:msubsup><mml:mo>+</mml:mo></mml:mrow></mml:math></inline-formula>NO<inline-formula><mml:math id="M32" display="inline"><mml:mrow><mml:msubsup><mml:mi/><mml:mn mathvariant="normal">3</mml:mn><mml:mo>-</mml:mo></mml:msubsup></mml:mrow></mml:math></inline-formula>. <bold>(d)</bold> Si(OH)<inline-formula><mml:math id="M33" display="inline"><mml:msub><mml:mi/><mml:mn mathvariant="normal">4</mml:mn></mml:msub></mml:math></inline-formula>. <bold>(e)</bold> Chlorophyll <inline-formula><mml:math id="M34" display="inline"><mml:mi>a</mml:mi></mml:math></inline-formula> (chl <inline-formula><mml:math id="M35" display="inline"><mml:mi>a</mml:mi></mml:math></inline-formula>). <bold>(f)</bold> <italic>Synechococcus</italic>. <bold>(g)</bold> Photosynthetic
eukaryotes. <bold>(h)</bold> Cryptophytes. <bold>(i)</bold> Heterotrophic (non-pigmented) bacteria.
<bold>(j)</bold> Small bacteria (smaller than standard non-pigmented bacteria in the
system).</p></caption>
          <?xmltex \igopts{width=341.433071pt}?><graphic xlink:href="https://bg.copernicus.org/articles/20/1277/2023/bg-20-1277-2023-f02.png"/>

        </fig>

      <p id="d1e667">DNA samples that were analyzed were taken in M1 and the Pacific on days 1,
8, 15, 24, 32, 36, 42, and 48. A single DNA sample was analyzed for each
day. Flow cytometry samples were collected roughly every other day. Water
for eDNA and flow cytometry measurements was collected using the IWS to
evenly sample the upper portion of the water column; the depths sampled were
0–5 m on days 1 and 2, 0–10 m from day 3 to 28, and 0–12.5 m from
day 29 to 50. These sampling depths sampled the top layer of the mesocosm,
which was almost entirely above the depths at which the salt brine solution
was injected. After transport back to shore, eDNA samples were collected by
filtering 250 mL of water onto a 47 mm diameter 0.22 <inline-formula><mml:math id="M36" display="inline"><mml:mrow class="unit"><mml:mi mathvariant="normal">µ</mml:mi></mml:mrow></mml:math></inline-formula>m pore size
polyvinylidene difluoride membrane filter (Millipore, USA) using a vacuum
pump. All filters were flash frozen in liquid nitrogen and stored at
<inline-formula><mml:math id="M37" display="inline"><mml:mo>-</mml:mo></mml:math></inline-formula>80 <inline-formula><mml:math id="M38" display="inline"><mml:msup><mml:mi/><mml:mo>∘</mml:mo></mml:msup></mml:math></inline-formula>C before being shipped on dry ice to California, USA, for
analysis.</p>
      <p id="d1e695">Field controls consisting of 250 mL of filtered reverse osmosis (RO) and
MilliQ water were collected on day 3 of the experiment in order to
characterize any contaminating taxa in these systems and later steps. No DNA
was detected in these controls using NanoDrop 1000 spectrophotometer
(Thermo Fisher Scientific, Waltham, MA) measurements; environmental samples
ranged from 19.9–139.3 ng <inline-formula><mml:math id="M39" display="inline"><mml:mrow class="unit"><mml:mi mathvariant="normal">µ</mml:mi></mml:mrow></mml:math></inline-formula>L<inline-formula><mml:math id="M40" display="inline"><mml:msup><mml:mi/><mml:mrow><mml:mo>-</mml:mo><mml:mn mathvariant="normal">1</mml:mn></mml:mrow></mml:msup></mml:math></inline-formula>. However, COI, 18S, and 16S rRNA PCR
amplification yielded slight amplification, and PCR products were sequenced
(Table S1). After normalization steps, the dominant reads in the bacterial
portion of the 16S rRNA sequences consisted of Betaproteobacteria
(36.2 %) that were not prominent in field samples (0.27 % mean
proportion of reads in field samples). The greatest proportion of plastidial
reads in the field blanks were multiple diatom amplicon sequence variants (ASVs) (66.7 % of reads),
with the same ASVs composing 42.8 % of reads in the field samples. In the
COI reads, most ASVs found in the field blanks were also not prominent in
the field samples, with the exception of the calanoid copepod <italic>Paracalanus</italic> (12.4 % of
reads in field blanks, 13.3 % of reads in field samples). In the 18S
reads, the top ASVs in the field blanks were the copepods <italic>Hemicyclops thalassius</italic>  (30.0 % of reads
in field blanks, 3.9 % of reads in environmental samples) and
<italic>Paracalanus</italic> (11.7 % of reads in field blanks, 14.6 % of reads in environmental
samples). While this indicates that there may have been a low level of
field-based cross-contamination in our environmental samples, which is found
in most eDNA studies (and is a near inevitability when sampling in a remote
location without a dedicated molecular laboratory), these reads were not
removed from our analyses.</p>
</sec>
<sec id="Ch1.S2.SS3">
  <label>2.3</label><title>Flow cytometry</title>
      <p id="d1e735">Triplicate samples of 1 mL volume each were taken and preserved with
glutaraldehyde (EM grade, final concentration of 0.25 %). The samples were
then incubated for 20 min in the dark and subsequently treated the same
way as the eDNA samples. Photoautotrophs (photosynthetic eukaryotes,
<italic>Synechococcus</italic>, and <italic>Prochlorococcus</italic> were present) and heterotrophic bacteria were enumerated on a BD
Influx cell sorter (BD Biosciences, USA) equipped with a 488 nm argon laser
(200 mW) and a 70 <inline-formula><mml:math id="M41" display="inline"><mml:mrow class="unit"><mml:mi mathvariant="normal">µ</mml:mi></mml:mrow></mml:math></inline-formula>m nozzle running with 0.2 <inline-formula><mml:math id="M42" display="inline"><mml:mrow class="unit"><mml:mi mathvariant="normal">µ</mml:mi></mml:mrow></mml:math></inline-formula>m pre-filtered
1<inline-formula><mml:math id="M43" display="inline"><mml:mi>X</mml:mi></mml:math></inline-formula> PBS (10<inline-formula><mml:math id="M44" display="inline"><mml:mi>X</mml:mi></mml:math></inline-formula> PBS, pH 7.4, Life Technologies). Prior to the running of each
sample, fluorescent polystyrene beads (0.75 <inline-formula><mml:math id="M45" display="inline"><mml:mrow class="unit"><mml:mi mathvariant="normal">µ</mml:mi></mml:mrow></mml:math></inline-formula>m yellow green beads,
Polysciences, Inc) were added for reference. For calculation of the total
volume analyzed, the samples were weighed before and after each run. For
counts of photoautotrophs, the system was triggered on forward angle light
scatter (FALS), and red chlorophyll autofluorescence (692/40 nm band-pass
filter) as well as orange phycoerythrin autofluorescence (572/27 nm
band-pass filter) versus FALS were recorded over 8 min, running at
<inline-formula><mml:math id="M46" display="inline"><mml:mo>∼</mml:mo></mml:math></inline-formula> 25 <inline-formula><mml:math id="M47" display="inline"><mml:mrow class="unit"><mml:mi mathvariant="normal">µ</mml:mi></mml:mrow></mml:math></inline-formula>L min<inline-formula><mml:math id="M48" display="inline"><mml:msup><mml:mi/><mml:mrow><mml:mo>-</mml:mo><mml:mn mathvariant="normal">1</mml:mn></mml:mrow></mml:msup></mml:math></inline-formula>. To count heterotrophic bacteria,
the samples were stained with SYBR Green I (10 000<inline-formula><mml:math id="M49" display="inline"><mml:mo>×</mml:mo></mml:math></inline-formula> SYBR Green I, Thermo
Fisher; final concentration of 0.5<inline-formula><mml:math id="M50" display="inline"><mml:mo>×</mml:mo></mml:math></inline-formula> with 15 min incubation time in the
dark) and was triggered on green fluorescence (520/35 nm band-pass filter).
The samples were run for 1 min. at <inline-formula><mml:math id="M51" display="inline"><mml:mo>∼</mml:mo></mml:math></inline-formula> 25 <inline-formula><mml:math id="M52" display="inline"><mml:mrow class="unit"><mml:mi mathvariant="normal">µ</mml:mi></mml:mrow></mml:math></inline-formula>L min<inline-formula><mml:math id="M53" display="inline"><mml:msup><mml:mi/><mml:mrow><mml:mo>-</mml:mo><mml:mn mathvariant="normal">1</mml:mn></mml:mrow></mml:msup></mml:math></inline-formula>.</p>
      <p id="d1e852">Flow Cytometry Standard (FCS) files were processed in WinList 3D 9.0.1 (Verity Software House, Topsham
ME, USA). Among other bacterial populations, a unique population of presumed
bacteria appeared in mesocosm and coastal samples after day 24 of the study
and was gated in accordance with the representative cytogram (Fig. S1).</p>
</sec>
<sec id="Ch1.S2.SS4">
  <label>2.4</label><title>DNA extraction</title>
      <p id="d1e863">DNA from filters was extracted using the DNeasy<sup>®</sup> Blood and
Tissue kit (Qiagen, Germantown, MD) following standard protocol, with some
modifications that included an overnight incubation and increasing the
amount of lysis buffer to completely submerge the filter during lysis
(Walz et al., 2019). DNA extraction
concentrations were quantified using NanoDrop 1000 spectrophotometer
(Thermo Fisher Scientific, Waltham, MA) measurements.</p><?xmltex \hack{\newpage}?>
</sec>
<?pagebreak page1281?><sec id="Ch1.S2.SS5">
  <label>2.5</label><title>DNA amplification and sequencing</title>
<sec id="Ch1.S2.SS5.SSS1">
  <label>2.5.1</label><title>Cytochrome oxidase I (COI), 18S rRNA, and 12S rRNA</title>
      <?pagebreak page1282?><p id="d1e886">PCR reactions for COI and the 12S rRNA gene were run with Fluidigm two-step
amplification protocol for each sample (COI, Closek et al., 2018b; 12S, Pitz et al., 2020), while PCR reactions for the 18S
rRNA gene were run using 12 basepair Golay barcoded reverse primers
(Closek et al., 2018a). For COI, the
primary PCR primers used are from
Leray et al., 2013, and
are as follows: Fluidigm CS1 <inline-formula><mml:math id="M54" display="inline"><mml:mo>+</mml:mo></mml:math></inline-formula> <bold>mlCOIinfF</bold> (forward) is
ACACTGACGACATGGTTCTACA <bold>GGWACWGGWTGAACWGTWTAYCCYCC</bold>, and Fluidigm
CS2<inline-formula><mml:math id="M55" display="inline"><mml:mo>+</mml:mo></mml:math></inline-formula><bold>HCO2198</bold> (reverse) is TACGGTAGCAGAGACTTGGTCT
<bold>TAAACTTCAGGGTGACCAAAAAATCA.</bold> For 18S, primary PCR primers used are
from Amaral-Zettler et al. (2009) and are
as follows: Euk1391F (forward) is AATGATACGGCGACCACCGAGATCTACAC  TATCGCCGTT CG <bold>GTACACACCGCCCGTC</bold>, and EukBr (reverse) is  CAAGCAGAAGACGGCATACGAGAT  XXXXXXXXXXXX AGTCAGTCAG CA  <bold>TGATCCTTCTGCAGGTTCACCTAC</bold> (where XXXXXXXXXXXX  is a
unique 12 bp barcode location; all primers listed in 5<inline-formula><mml:math id="M56" display="inline"><mml:msup><mml:mi/><mml:mo>′</mml:mo></mml:msup></mml:math></inline-formula> to 3<inline-formula><mml:math id="M57" display="inline"><mml:msup><mml:mi/><mml:mo>′</mml:mo></mml:msup></mml:math></inline-formula> direction).
For 12S, primary PCR primers used are from Miya et al. (2015)
and are as follows: Fluidigm CS1 <inline-formula><mml:math id="M58" display="inline"><mml:mo>+</mml:mo></mml:math></inline-formula> <bold>12S MiFish_U</bold> (forward) is ACACTGACGACATGGTTCTACA<bold>GTCGGTAAAACTCGTGCCAGC</bold> and
Fluidigm CS2 <inline-formula><mml:math id="M59" display="inline"><mml:mo>+</mml:mo></mml:math></inline-formula> 1<bold>2S MiFish_U</bold> (reverse) is</p>
      <p id="d1e963">TACGGTAGCAGAGACTTGGTCT</p>
      <p id="d1e966"><bold>CATAGTGGGGTATCTAATCCCAGTTTG</bold>.</p>
      <p id="d1e971">For each of the three markers, primary PCR amplifications were carried out
in triplicate 25 <inline-formula><mml:math id="M60" display="inline"><mml:mrow class="unit"><mml:mi mathvariant="normal">µ</mml:mi></mml:mrow></mml:math></inline-formula>L reactions using 1 <inline-formula><mml:math id="M61" display="inline"><mml:mrow class="unit"><mml:mi mathvariant="normal">µ</mml:mi></mml:mrow></mml:math></inline-formula>L DNA extract, 12.5 <inline-formula><mml:math id="M62" display="inline"><mml:mrow class="unit"><mml:mi mathvariant="normal">µ</mml:mi></mml:mrow></mml:math></inline-formula>L
AmpliTaq Gold Fast PCR master mix (Applied Biosystems), 1 <inline-formula><mml:math id="M63" display="inline"><mml:mrow class="unit"><mml:mi mathvariant="normal">µ</mml:mi></mml:mrow></mml:math></inline-formula>L each of
forward and reverse primers (5 <inline-formula><mml:math id="M64" display="inline"><mml:mrow class="unit"><mml:mi mathvariant="normal">µ</mml:mi></mml:mrow></mml:math></inline-formula>M), and 9.5 <inline-formula><mml:math id="M65" display="inline"><mml:mrow class="unit"><mml:mi mathvariant="normal">µ</mml:mi></mml:mrow></mml:math></inline-formula>L molecular-biology-grade water. PCR reactions were run in 96-well plates with a no template control (NTC) run in
triplicate for each plate. Primary COI cycling parameters were 95 <inline-formula><mml:math id="M66" display="inline"><mml:msup><mml:mi/><mml:mo>∘</mml:mo></mml:msup></mml:math></inline-formula>C for 10 min followed by 16 cycles of 94 <inline-formula><mml:math id="M67" display="inline"><mml:msup><mml:mi/><mml:mo>∘</mml:mo></mml:msup></mml:math></inline-formula>C for 10 s; 62 <inline-formula><mml:math id="M68" display="inline"><mml:msup><mml:mi/><mml:mo>∘</mml:mo></mml:msup></mml:math></inline-formula>C for 30 s; 68 <inline-formula><mml:math id="M69" display="inline"><mml:msup><mml:mi/><mml:mo>∘</mml:mo></mml:msup></mml:math></inline-formula>C for 60 s,
next followed by 25 cycles of 94 <inline-formula><mml:math id="M70" display="inline"><mml:msup><mml:mi/><mml:mo>∘</mml:mo></mml:msup></mml:math></inline-formula>C for 10 s; 46 <inline-formula><mml:math id="M71" display="inline"><mml:msup><mml:mi/><mml:mo>∘</mml:mo></mml:msup></mml:math></inline-formula>C for 30 s; 68 <inline-formula><mml:math id="M72" display="inline"><mml:msup><mml:mi/><mml:mo>∘</mml:mo></mml:msup></mml:math></inline-formula>C for 60 s; and a final
step of 72 <inline-formula><mml:math id="M73" display="inline"><mml:msup><mml:mi/><mml:mo>∘</mml:mo></mml:msup></mml:math></inline-formula>C for 10 min. Primary 18S rRNA cycling parameters
were 95 <inline-formula><mml:math id="M74" display="inline"><mml:msup><mml:mi/><mml:mo>∘</mml:mo></mml:msup></mml:math></inline-formula>C for 10 min followed by 35 cycles of 94 <inline-formula><mml:math id="M75" display="inline"><mml:msup><mml:mi/><mml:mo>∘</mml:mo></mml:msup></mml:math></inline-formula>C
for 45 s, 57 <inline-formula><mml:math id="M76" display="inline"><mml:msup><mml:mi/><mml:mo>∘</mml:mo></mml:msup></mml:math></inline-formula>C for 30 s, 68 <inline-formula><mml:math id="M77" display="inline"><mml:msup><mml:mi/><mml:mo>∘</mml:mo></mml:msup></mml:math></inline-formula>C for 90 s, and a final elongation step of 72 <inline-formula><mml:math id="M78" display="inline"><mml:msup><mml:mi/><mml:mo>∘</mml:mo></mml:msup></mml:math></inline-formula>C for 10 min. Primary
12S rRNA cycling parameters were 95 <inline-formula><mml:math id="M79" display="inline"><mml:msup><mml:mi/><mml:mo>∘</mml:mo></mml:msup></mml:math></inline-formula>C for 15 min followed by 13 cycles of 94 <inline-formula><mml:math id="M80" display="inline"><mml:msup><mml:mi/><mml:mo>∘</mml:mo></mml:msup></mml:math></inline-formula>C for 30 s; 69.5 <inline-formula><mml:math id="M81" display="inline"><mml:msup><mml:mi/><mml:mo>∘</mml:mo></mml:msup></mml:math></inline-formula>C for 30 s
(changes <inline-formula><mml:math id="M82" display="inline"><mml:mo>-</mml:mo></mml:math></inline-formula>1.5 <inline-formula><mml:math id="M83" display="inline"><mml:msup><mml:mi/><mml:mo>∘</mml:mo></mml:msup></mml:math></inline-formula>C per cycle); 72 <inline-formula><mml:math id="M84" display="inline"><mml:msup><mml:mi/><mml:mo>∘</mml:mo></mml:msup></mml:math></inline-formula>C for 90 s, next
followed by 25 cycles of 94 <inline-formula><mml:math id="M85" display="inline"><mml:msup><mml:mi/><mml:mo>∘</mml:mo></mml:msup></mml:math></inline-formula>C for 30 s; 50 <inline-formula><mml:math id="M86" display="inline"><mml:msup><mml:mi/><mml:mo>∘</mml:mo></mml:msup></mml:math></inline-formula>C
for 30 s; 72 <inline-formula><mml:math id="M87" display="inline"><mml:msup><mml:mi/><mml:mo>∘</mml:mo></mml:msup></mml:math></inline-formula>C for 45 s; and a final step of 72 <inline-formula><mml:math id="M88" display="inline"><mml:msup><mml:mi/><mml:mo>∘</mml:mo></mml:msup></mml:math></inline-formula>C for 10 min.</p>
      <p id="d1e1232">Following PCR, the pooled PCR products for each genetic marker were run
through an agarose gel to confirm the presence of target bands and inspected
for degree of amplification as well as absence of any non-specific
amplification. PCR products were purified and size selected using the
Agencourt AMPure XP bead system (Beckman Coulter, USA). A second agarose gel
was run to confirm primer removal and retention of target amplicons after
purification.</p>
      <p id="d1e1235">Library preparation and sequencing was conducted at the Research Technology
Support Facility (RTSF) Genomics Core at Michigan State University (MSU), as
was secondary amplification for COI and 12S. PCR products were run through a
Invitrogen SequalPrep Normalization Plate (Thermo Fisher Scientific) using
the manufacturer's protocol to create pooled libraries. The pooled product
was loaded on a standard MiSeq v2 flow cell and sequenced in a <inline-formula><mml:math id="M89" display="inline"><mml:mrow><mml:mn mathvariant="normal">2</mml:mn><mml:mo>×</mml:mo><mml:mn mathvariant="normal">250</mml:mn></mml:mrow></mml:math></inline-formula> bp (COI,
12S rRNA) or <inline-formula><mml:math id="M90" display="inline"><mml:mrow><mml:mn mathvariant="normal">2</mml:mn><mml:mo>×</mml:mo><mml:mn mathvariant="normal">150</mml:mn></mml:mrow></mml:math></inline-formula> bp (18S rRNA) paired end format using a v2 500-cycle
MiSeq reagent cartridge. The MiSeq run was performed with a 10 % PhiX
spike. Custom sequencing primers were added to appropriate wells of the
reagent cartridge. Base calling was done by Illumina real time analysis
(RTA) v1.18.54, and output of RTA was demultiplexed and converted to FastQ
format with Illumina Bcl2fastq v2.18.0.</p>
</sec>
<sec id="Ch1.S2.SS5.SSS2">
  <label>2.5.2</label><title>16S rRNA</title>
      <p id="d1e1270">Prior to amplification, DNA was diluted to 5 ng <inline-formula><mml:math id="M91" display="inline"><mml:mrow class="unit"><mml:mi mathvariant="normal">µ</mml:mi></mml:mrow></mml:math></inline-formula>L<inline-formula><mml:math id="M92" display="inline"><mml:msup><mml:mi/><mml:mrow><mml:mo>-</mml:mo><mml:mn mathvariant="normal">1</mml:mn></mml:mrow></mml:msup></mml:math></inline-formula> with TE pH 8.
The V1–V2 16S rRNA gene region was amplified as previously described
(Sudek et al., 2015), with 5 <inline-formula><mml:math id="M93" display="inline"><mml:mrow class="unit"><mml:mi mathvariant="normal">µ</mml:mi></mml:mrow></mml:math></inline-formula>L of
10<inline-formula><mml:math id="M94" display="inline"><mml:mo>×</mml:mo></mml:math></inline-formula> buffer, 1 U of HiFi-Taq, 1.6 mM MgSO4, 5 ng of template DNA,
and 200 nM of 27F (AGRGTTYGATYMTGGCTCAG;  Daims et
al., 1999) and 338RPL primer (GCWGCCWCCCGTAGGWGT;
Morris et al., 2002). PCR cycling parameters
were 95 <inline-formula><mml:math id="M95" display="inline"><mml:msup><mml:mi/><mml:mo>∘</mml:mo></mml:msup></mml:math></inline-formula>C for 2 min, 30 cycles of 94 <inline-formula><mml:math id="M96" display="inline"><mml:msup><mml:mi/><mml:mo>∘</mml:mo></mml:msup></mml:math></inline-formula>C for 15 s, 55 <inline-formula><mml:math id="M97" display="inline"><mml:msup><mml:mi/><mml:mo>∘</mml:mo></mml:msup></mml:math></inline-formula>C for 30 s, and 68 <inline-formula><mml:math id="M98" display="inline"><mml:msup><mml:mi/><mml:mo>∘</mml:mo></mml:msup></mml:math></inline-formula>C for 1 min,
followed by a final elongation at 68 <inline-formula><mml:math id="M99" display="inline"><mml:msup><mml:mi/><mml:mo>∘</mml:mo></mml:msup></mml:math></inline-formula>C for 7 min. Purification,
barcoding, library preparation, and sequencing were performed at the University
of Arizona with MiSeq <inline-formula><mml:math id="M100" display="inline"><mml:mrow><mml:mn mathvariant="normal">2</mml:mn><mml:mo>×</mml:mo><mml:mn mathvariant="normal">300</mml:mn></mml:mrow></mml:math></inline-formula> bp reads.</p>
</sec>
</sec>
<sec id="Ch1.S2.SS6">
  <label>2.6</label><title>Bioinformatics</title>
<sec id="Ch1.S2.SS6.SSS1">
  <label>2.6.1</label><title>Cytochrome oxidase I (COI), 18S rRNA, and 12S rRNA</title>
      <p id="d1e1382">The resulting Illumina sequence data were analyzed through a custom shell
script adapted from the banzai pipeline
(<uri>https://github.com/MBARI-BOG/BOG-Banzai-Dada2-Pipeline</uri>, last access: 20 October 2020;
O'donnell et al., 2016). Complete script and parameters are included in the
Supplement. Within the script, primer sequences were first removed from
fastq files through the program Atropos (Didion
et al., 2017). Fastq files were then fed into the DADA2 program
(Callahan et al., 2016). DADA2 models error on a
per-Illumina run basis, controlling for read quality and picking ASV sequences that represent biological variability
rather than sequencing error (Callahan et al.,
2016). Within DADA2, reads were trimmed to remove low-quality regions and
filtered by quality score, sequencing errors were modeled and removed, and
reads were then merged and chimeric sequences removed. Taxonomy was assigned
to the resulting ASV sequences through blastn searches to NCBI GenBank's
non-redundant nucleotide database (nt)
(Camacho et
al., 2009; Agarwala et al., 2018). Blast results were filtered using
MEGAN6's lowest common ancestor (LCA) algorithm
(Huson et al., 2016). Only hits with <inline-formula><mml:math id="M101" display="inline"><mml:mo>≥</mml:mo></mml:math></inline-formula> 80 % sequence identity, with <inline-formula><mml:math id="M102" display="inline"><mml:mo>≥</mml:mo></mml:math></inline-formula> 100 bitscore, and whose bitscores were
within the top 2 % of the highest bitscore value for each ASV were
considered by MEGAN6. The MEGAN6 parameter LCA percent was from 0.80 to
0.85, depending on the marker, allowing for up to 15 %–20 % of top hits
to be off target and still have the majority taxonomy assigned. This
parameter value was chosen to allow for minor numbers of incorrectly
annotated GenBank entries – effectively allowing for ASVs which had many
high-quality hits to a taxa to still be assigned to that taxa even if there
existed a high-bitscore hit to another GenBank sequence annotated to an
unrelated taxa. Despite the issue that this introduces potentially
assigning species-level identification to an ASV with multiple strong
matches, we decided that this compromise was necessary<?pagebreak page1283?> to allow species
identification with an imperfectly curated reference database. We decided
this was more advantageous than the disadvantage caused by ignoring small
numbers of true closely related sequences. Furthermore, post-MEGAN6
filtering was performed to ensure only contigs with a hit of <inline-formula><mml:math id="M103" display="inline"><mml:mo>≥</mml:mo></mml:math></inline-formula> 97 %
sequence identity and <inline-formula><mml:math id="M104" display="inline"><mml:mo>≥</mml:mo></mml:math></inline-formula> 200 bitscore were annotated to the species
level. Only contigs with a hit of <inline-formula><mml:math id="M105" display="inline"><mml:mo>≥</mml:mo></mml:math></inline-formula> 95 % sequence identity and <inline-formula><mml:math id="M106" display="inline"><mml:mo>≥</mml:mo></mml:math></inline-formula> 150 bitscore were annotated to the genus level. Annotations were elevated
to the next highest taxonomic level for contigs that failed those
conditions.</p>
</sec>
<sec id="Ch1.S2.SS6.SSS2">
  <label>2.6.2</label><title>16S rRNA</title>
      <p id="d1e1439">Demultiplexed reads were imported into QIIME2
(Bolyen et al.,
2019) and cutadapt (Martin, 2011) trim-paired was
used to trim primers. Trimmed reads were denoised with DADA2
(Callahan et al., 2016) denoise-paired command,
with a truncation of the forward and reverse reads to 250 and 225 bp,
respectively. Resulting ASVs were classified in QIIME2 with the
feature-classifier classify-consensus-blast
(Camacho et al., 2009) command, with a percent
identity of 0.95, maximum number of accepted hits of 5 and a consensus of 0.7
against the 99 % representative sequences of SILVA 132
(Quast et al., 2013) and both 18S and 16S rRNA
gene references. A bacterial ASV table was then generated by removing
mitochondrial and plastidial sequences. Plastidial sequences were then
selected based on the SILVA classification and reclassified with the
Phytoref database (Decelle et al., 2015)
using the same settings as before except with a percent identity of 0.90.
The five most abundant cyanobacterial ASVs were further analyzed by a manual
blast against NCBI-nt excluding environmental sequences.</p>
</sec>
</sec>
<sec id="Ch1.S2.SS7">
  <label>2.7</label><title>Quality control and decontamination</title>
      <p id="d1e1451">Following the bioinformatic pipeline, the COI, 18S rRNA, and 12S rRNA
sequencing results were passed through custom R ver. 3.6.0
(R Core Team, 2019) decontamination scripts. For each
plate, we first removed all singleton ASVs. Next, for each ASV that was
detected in at least one of the PCR blanks on the plate, we determined the
maximum number of reads of that ASV in any of the individual PCR blanks and
subtracted this value from the reads of the ASV in each of the environmental
samples. This was done to address cross-contamination from various sources,
such as tag jumping (Schnell et al., 2015). As
mentioned previously in Sect. 2.2, no decontamination steps were taken
using the field blank samples. Finally, we removed all reads assigned to
common terrestrial contaminants: orders Rodentia and Lagomorpha; families
Hominidae, Bovidae, Felidae, and Canidae; and genera <italic>Gallus</italic> and <italic>Meleagris</italic>. These
decontamination steps were not run for 16S rRNA sequences because the PCR
blanks were not sequenced.</p><?xmltex \hack{\newpage}?>
</sec>
<sec id="Ch1.S2.SS8">
  <label>2.8</label><title>Statistical analyses</title>
      <p id="d1e1469">Beta diversity analyses were run separately on the five datasets (COI, 18S
rRNA, 12S rRNA, 16S rRNA bacterial sequences, and 16S rRNA plastidial
sequences) using the QIIME2
(Bolyen et al.,
2019) DEICODE plugin. The beta diversity analyses for 12S rRNA are included
in the Supplement (Fig. S2) since vertebrates were excluded from the
mesocosm (water filtered through a 3 mm mesh), and vertebrate eDNA that was
detected was (1) found during our first sampling, and then it decayed and
disappeared at a rate consistent with experimental results
(Sassoubre et al., 2016); (2) the
result of the intentional addition of fish eggs; and (3) the unintentional
addition from seabird faeces. Through matrix completion and robust Aitchison
PCA (RPCA), DEICODE (Martino et al., 2019) is
particularly well-suited to handle the sparseness inherent to sequencing
data. A PERMANOVA test was also run in QIIME2 on the Aitchison distance
matrix produced by DEICODE to determine the significance of the variance
between M1 samples following OMZ water addition and the other samples
(Pacific and first two M1 samples). Based on the results of the RPCA and
PERMANOVA, which showed a clear differentiation between the M1 samples
following OMZ water addition (day 15 and on) and Pacific surface water
samples on PC1 for the four primary datasets analyzed for beta diversity
(all but 12S rRNA), the loading scores on PC1 were used to identify ASVs
that were driving the divergence between M1 and the Pacific. The PC results
presented are constrained to ASVs that were consistently present throughout
the experiment, as determined by ASVs that composed at least 0.1 % of the
reads in 25 % of the samples. Heatmaps of relative abundances were
constructed for all ASVs in all samples (Fig. S3); the criteria for inclusion of
ASVs in these heatmaps was a relative abundance within the top 10 most
abundant ASVs in any sample within a respective dataset and greater than
1 % of the reads in any sample.</p>

      <?xmltex \floatpos{t}?><fig id="Ch1.F3" specific-use="star"><?xmltex \currentcnt{3}?><?xmltex \def\figurename{Figure}?><label>Figure 3</label><caption><p id="d1e1474">Beta diversity analyses using DEICODE robust Aitchison PCA for <bold>(a)</bold>
COI, <bold>(b)</bold> 18S rRNA, <bold>(c)</bold> V1–V2 16S rRNA plastidial ASVs, and <bold>(d)</bold> V1–V2 16S
rRNA bacterial ASVs, including photosynthetic taxa. Data points represent
individual samples; the number next to each data point indicates the day
collected. ASV loadings on PC1 from the DEICODE robust Aitchison PCA for <bold>(e)</bold>
COI, <bold>(f)</bold> 18S rRNA, <bold>(g)</bold> V1–V2 16S rRNA plastidial ASVs, and <bold>(h)</bold> V1–V2 16S
rRNA bacterial ASVs. As seen in <bold>(a)</bold>, <bold>(b)</bold>, <bold>(c)</bold>, and <bold>(d)</bold> and confirmed by a
PERMANOVA test, PC1 separates the Pacific samples and pre-OMZ water addition
M1 samples from the post-OMZ water addition M1 samples (days 15<inline-formula><mml:math id="M107" display="inline"><mml:mo>+</mml:mo></mml:math></inline-formula>), and
thus positive loading scores are associated with the mesocosm, whereas
negative loading scores are associated with the Pacific samples. The text
adjacent to the loading scores represents the lowest taxonomy to which that ASV
was annotated. The taxonomy assigned to 16S rRNA ASVs corresponds to that of
the SILVA taxonomy.</p></caption>
          <?xmltex \igopts{width=503.61378pt}?><graphic xlink:href="https://bg.copernicus.org/articles/20/1277/2023/bg-20-1277-2023-f03.png"/>

        </fig>

</sec>
</sec>
<sec id="Ch1.S3">
  <label>3</label><title>Results</title>
<sec id="Ch1.S3.SS1">
  <label>3.1</label><?xmltex \opttitle{Physicochemical conditions, inorganic nutrients, and chlorophyll~$a$}?><title>Physicochemical conditions, inorganic nutrients, and chlorophyll <inline-formula><mml:math id="M108" display="inline"><mml:mi>a</mml:mi></mml:math></inline-formula></title>
      <p id="d1e1551">The mesocosm experiment occurred during an unusual warming event described
as a coastal El Niño
(Garreaud, 2018; Bach
et al., 2020). Sea surface temperature (SST) was 1 to 1.5 <inline-formula><mml:math id="M109" display="inline"><mml:msup><mml:mi/><mml:mo>∘</mml:mo></mml:msup></mml:math></inline-formula>C
warmer than average (Herring et al., 2019) at the
start of the experiment. SST fluctuated over the experiment (Fig. 2a) but
returned to average values about 5 weeks into the experiment. Temperature in
the mesocosms tracked that of the surrounding water (Fig. 2a). Salinity in
the mesocosms began with levels similar to the open ocean and was modified
via NaCl brine additions to depths below 10 m on day 13 and again on day 33
(Fig. 2b).</p>
      <?pagebreak page1284?><p id="d1e1563">NO<inline-formula><mml:math id="M110" display="inline"><mml:mrow><mml:msubsup><mml:mi/><mml:mn mathvariant="normal">2</mml:mn><mml:mo>-</mml:mo></mml:msubsup><mml:mo>+</mml:mo></mml:mrow></mml:math></inline-formula> NO<inline-formula><mml:math id="M111" display="inline"><mml:mrow><mml:msubsup><mml:mi/><mml:mn mathvariant="normal">3</mml:mn><mml:mo>-</mml:mo></mml:msubsup></mml:mrow></mml:math></inline-formula> (NO<inline-formula><mml:math id="M112" display="inline"><mml:mrow><mml:msubsup><mml:mi/><mml:mi>x</mml:mi><mml:mo>-</mml:mo></mml:msubsup></mml:mrow></mml:math></inline-formula>) concentration in M1 was
initially 6.9 <inline-formula><mml:math id="M113" display="inline"><mml:mrow class="unit"><mml:mi mathvariant="normal">µ</mml:mi></mml:mrow></mml:math></inline-formula>mol L<inline-formula><mml:math id="M114" display="inline"><mml:msup><mml:mi/><mml:mrow><mml:mo>-</mml:mo><mml:mn mathvariant="normal">1</mml:mn></mml:mrow></mml:msup></mml:math></inline-formula> and declined steadily over time (Fig. 2c). M1 received addition of OMZ water with a NO<inline-formula><mml:math id="M115" display="inline"><mml:mrow><mml:msubsup><mml:mi/><mml:mi>x</mml:mi><mml:mo>-</mml:mo></mml:msubsup></mml:mrow></mml:math></inline-formula> concentration of
0.3 <inline-formula><mml:math id="M116" display="inline"><mml:mrow class="unit"><mml:mi mathvariant="normal">µ</mml:mi></mml:mrow></mml:math></inline-formula>mol L<inline-formula><mml:math id="M117" display="inline"><mml:msup><mml:mi/><mml:mrow><mml:mo>-</mml:mo><mml:mn mathvariant="normal">1</mml:mn></mml:mrow></mml:msup></mml:math></inline-formula> on days 11 and 12 and reached the detection
threshold of 0.2 <inline-formula><mml:math id="M118" display="inline"><mml:mrow class="unit"><mml:mi mathvariant="normal">µ</mml:mi></mml:mrow></mml:math></inline-formula>mol L<inline-formula><mml:math id="M119" display="inline"><mml:msup><mml:mi/><mml:mrow><mml:mo>-</mml:mo><mml:mn mathvariant="normal">1</mml:mn></mml:mrow></mml:msup></mml:math></inline-formula> around day 20 (Fig. 2c). Conversely,
NO<inline-formula><mml:math id="M120" display="inline"><mml:mrow><mml:msubsup><mml:mi/><mml:mi>x</mml:mi><mml:mo>-</mml:mo></mml:msubsup></mml:mrow></mml:math></inline-formula> concentrations in the Pacific at the study site were considerably
higher and more variable, ranging between 2.7–19.2 <inline-formula><mml:math id="M121" display="inline"><mml:mrow class="unit"><mml:mi mathvariant="normal">µ</mml:mi></mml:mrow></mml:math></inline-formula>mol L<inline-formula><mml:math id="M122" display="inline"><mml:msup><mml:mi/><mml:mrow><mml:mo>-</mml:mo><mml:mn mathvariant="normal">1</mml:mn></mml:mrow></mml:msup></mml:math></inline-formula>
and reaching particularly high values during the second half of the
experiment (Fig. 2c). The concentration of Si(OH)<inline-formula><mml:math id="M123" display="inline"><mml:msub><mml:mi/><mml:mn mathvariant="normal">4</mml:mn></mml:msub></mml:math></inline-formula> in M1 was initially
8.0 <inline-formula><mml:math id="M124" display="inline"><mml:mrow class="unit"><mml:mi mathvariant="normal">µ</mml:mi></mml:mrow></mml:math></inline-formula>mol L<inline-formula><mml:math id="M125" display="inline"><mml:msup><mml:mi/><mml:mrow><mml:mo>-</mml:mo><mml:mn mathvariant="normal">1</mml:mn></mml:mrow></mml:msup></mml:math></inline-formula> and declined to a value of 4.7 <inline-formula><mml:math id="M126" display="inline"><mml:mrow class="unit"><mml:mi mathvariant="normal">µ</mml:mi></mml:mrow></mml:math></inline-formula> mol L<inline-formula><mml:math id="M127" display="inline"><mml:msup><mml:mi/><mml:mrow><mml:mo>-</mml:mo><mml:mn mathvariant="normal">1</mml:mn></mml:mrow></mml:msup></mml:math></inline-formula>
on day 10, prior to the addition of OMZ water with a Si(OH)<inline-formula><mml:math id="M128" display="inline"><mml:msub><mml:mi/><mml:mn mathvariant="normal">4</mml:mn></mml:msub></mml:math></inline-formula> concentration of
17.4 <inline-formula><mml:math id="M129" display="inline"><mml:mrow class="unit"><mml:mi mathvariant="normal">µ</mml:mi></mml:mrow></mml:math></inline-formula>mol L<inline-formula><mml:math id="M130" display="inline"><mml:msup><mml:mi/><mml:mrow><mml:mo>-</mml:mo><mml:mn mathvariant="normal">1</mml:mn></mml:mrow></mml:msup></mml:math></inline-formula>. The addition of OMZ water caused Si(OH)<inline-formula><mml:math id="M131" display="inline"><mml:msub><mml:mi/><mml:mn mathvariant="normal">4</mml:mn></mml:msub></mml:math></inline-formula> in
M1 to increase to 9.3 <inline-formula><mml:math id="M132" display="inline"><mml:mrow class="unit"><mml:mi mathvariant="normal">µ</mml:mi></mml:mrow></mml:math></inline-formula>mol L<inline-formula><mml:math id="M133" display="inline"><mml:msup><mml:mi/><mml:mrow><mml:mo>-</mml:mo><mml:mn mathvariant="normal">1</mml:mn></mml:mrow></mml:msup></mml:math></inline-formula> on day 13, after which its
concentration declined for the rest of the experiment, reaching a value of
3.6 <inline-formula><mml:math id="M134" display="inline"><mml:mrow class="unit"><mml:mi mathvariant="normal">µ</mml:mi></mml:mrow></mml:math></inline-formula>mol L<inline-formula><mml:math id="M135" display="inline"><mml:msup><mml:mi/><mml:mrow><mml:mo>-</mml:mo><mml:mn mathvariant="normal">1</mml:mn></mml:mrow></mml:msup></mml:math></inline-formula> on day 50 (Fig. 2d). In the Pacific, Si(OH)<inline-formula><mml:math id="M136" display="inline"><mml:msub><mml:mi/><mml:mn mathvariant="normal">4</mml:mn></mml:msub></mml:math></inline-formula>
concentrations fluctuated, ranging from a minimum of 6.6 <inline-formula><mml:math id="M137" display="inline"><mml:mrow class="unit"><mml:mi mathvariant="normal">µ</mml:mi></mml:mrow></mml:math></inline-formula>mol L<inline-formula><mml:math id="M138" display="inline"><mml:msup><mml:mi/><mml:mrow><mml:mo>-</mml:mo><mml:mn mathvariant="normal">1</mml:mn></mml:mrow></mml:msup></mml:math></inline-formula> on day 24 to a maximum of 18.7 <inline-formula><mml:math id="M139" display="inline"><mml:mrow class="unit"><mml:mi mathvariant="normal">µ</mml:mi></mml:mrow></mml:math></inline-formula>mol L<inline-formula><mml:math id="M140" display="inline"><mml:msup><mml:mi/><mml:mrow><mml:mo>-</mml:mo><mml:mn mathvariant="normal">1</mml:mn></mml:mrow></mml:msup></mml:math></inline-formula> on day 12 (Fig. 2d).</p>
      <p id="d1e1889">Chlorophyll <inline-formula><mml:math id="M141" display="inline"><mml:mi>a</mml:mi></mml:math></inline-formula> (chl <inline-formula><mml:math id="M142" display="inline"><mml:mi>a</mml:mi></mml:math></inline-formula>) concentration in M1 was initially 4.9 <inline-formula><mml:math id="M143" display="inline"><mml:mrow class="unit"><mml:mi mathvariant="normal">µ</mml:mi></mml:mrow></mml:math></inline-formula>g L<inline-formula><mml:math id="M144" display="inline"><mml:msup><mml:mi/><mml:mrow><mml:mo>-</mml:mo><mml:mn mathvariant="normal">1</mml:mn></mml:mrow></mml:msup></mml:math></inline-formula> and declined until reaching a minimum of 1.7 <inline-formula><mml:math id="M145" display="inline"><mml:mrow class="unit"><mml:mi mathvariant="normal">µ</mml:mi></mml:mrow></mml:math></inline-formula>g L<inline-formula><mml:math id="M146" display="inline"><mml:msup><mml:mi/><mml:mrow><mml:mo>-</mml:mo><mml:mn mathvariant="normal">1</mml:mn></mml:mrow></mml:msup></mml:math></inline-formula> on
day 6. Following OMZ water addition, chl <inline-formula><mml:math id="M147" display="inline"><mml:mi>a</mml:mi></mml:math></inline-formula> gradually increased until
approximately day 40, after which it increased rapidly. This rapid increase
in chl <inline-formula><mml:math id="M148" display="inline"><mml:mi>a</mml:mi></mml:math></inline-formula> in the final <inline-formula><mml:math id="M149" display="inline"><mml:mo>∼</mml:mo></mml:math></inline-formula> 10 d of the experiment, which was
seen across all eight mesocosms (Fig. 2e), has been attributed to
orni-eutrophication by defecating seabirds (Inca terns, <italic>Larosterna inca</italic>), who found
the mesocosms to be suitable resting places
(Bach et al., 2020). Chl <inline-formula><mml:math id="M150" display="inline"><mml:mi>a</mml:mi></mml:math></inline-formula> in the
Pacific was more variable and generally comparable to the range of chl <inline-formula><mml:math id="M151" display="inline"><mml:mi>a</mml:mi></mml:math></inline-formula>
concentrations found in the mesocosms until day 40.</p>
      <p id="d1e1987">The observed values of temperature, salinity, NO<inline-formula><mml:math id="M152" display="inline"><mml:mrow><mml:msubsup><mml:mi/><mml:mi>x</mml:mi><mml:mo>-</mml:mo></mml:msubsup></mml:mrow></mml:math></inline-formula>, Si(OH)<inline-formula><mml:math id="M153" display="inline"><mml:msub><mml:mi/><mml:mn mathvariant="normal">4</mml:mn></mml:msub></mml:math></inline-formula>,
and chl <inline-formula><mml:math id="M154" display="inline"><mml:mi>a</mml:mi></mml:math></inline-formula> in M1 were very similar to the values found in all eight mesocosms
(Fig. 2, with more detail in Bach et al., 2020), indicating that M1 was
representative of the overall abiotic and hence biotic conditions found
within the mesocosms.</p>
</sec>
<?pagebreak page1285?><sec id="Ch1.S3.SS2">
  <label>3.2</label><title>eDNA overview statistics</title>
      <p id="d1e2026">Across the five datasets, the unenclosed Pacific samples exhibited higher
alpha diversity relative to mesocosm at nearly all levels of taxonomy from
phyla to ASVs. Summary statistics are given in Table 1. A total of 1 219 350
COI, 1 759 671 18S rRNA, 217 398 12S rRNA, 241 783 16S rRNA plastidial, and
3 125 836 16S rRNA bacterial paired end reads passed filtering and
decontamination steps. These amplicons resulted in a total of 2434 COI
ASVs, 3296 18S rRNA ASVs, 470 12S rRNA ASVs, 258 16S rRNA chloroplast ASVs,
and 5786 16S rRNA bacterial ASVs (Table 1). These resulting ASVs form the
basis of the statistical analysis presented below.</p>

<?xmltex \floatpos{t}?><table-wrap id="Ch1.T1" specific-use="star"><?xmltex \currentcnt{1}?><label>Table 1</label><caption><p id="d1e2032">DNA sequencing statistics. The 16 total samples were divided
between 8 M1 (mesocosm) and 8 Pacific samples, with “Avg. reads” and
“Stdev” reflecting the average and standard deviation (respectively) of
the number of reads per sample. All other values represent the total sum
across all samples. Across all five datasets, the Pacific samples
consistently show a higher level of alpha diversity at all levels of
taxonomy.</p></caption><oasis:table frame="topbot"><oasis:tgroup cols="11">
     <oasis:colspec colnum="1" colname="col1" align="left"/>
     <oasis:colspec colnum="2" colname="col2" align="right"/>
     <oasis:colspec colnum="3" colname="col3" align="right" colsep="1"/>
     <oasis:colspec colnum="4" colname="col4" align="right"/>
     <oasis:colspec colnum="5" colname="col5" align="right" colsep="1"/>
     <oasis:colspec colnum="6" colname="col6" align="right"/>
     <oasis:colspec colnum="7" colname="col7" align="right" colsep="1"/>
     <oasis:colspec colnum="8" colname="col8" align="right"/>
     <oasis:colspec colnum="9" colname="col9" align="right" colsep="1"/>
     <oasis:colspec colnum="10" colname="col10" align="right"/>
     <oasis:colspec colnum="11" colname="col11" align="right"/>
     <oasis:thead>
       <oasis:row>
         <oasis:entry colname="col1"/>
         <oasis:entry namest="col2" nameend="col3" align="center" colsep="1">Cytochrome </oasis:entry>
         <oasis:entry namest="col4" nameend="col5" align="center" colsep="1">18S rRNA </oasis:entry>
         <oasis:entry namest="col6" nameend="col7" align="center" colsep="1">12S rRNA </oasis:entry>
         <oasis:entry namest="col8" nameend="col9" align="center" colsep="1">16S rRNA </oasis:entry>
         <oasis:entry namest="col10" nameend="col11" align="center">16S rRNA </oasis:entry>
       </oasis:row>
       <oasis:row>
         <oasis:entry colname="col1"/>
         <oasis:entry rowsep="1" namest="col2" nameend="col3" align="center" colsep="1">oxidase I </oasis:entry>
         <oasis:entry rowsep="1" namest="col4" nameend="col5" align="center" colsep="1"/>
         <oasis:entry rowsep="1" namest="col6" nameend="col7" align="center" colsep="1"/>
         <oasis:entry rowsep="1" namest="col8" nameend="col9" align="center" colsep="1">plastidial </oasis:entry>
         <oasis:entry rowsep="1" namest="col10" nameend="col11" align="center">bacterial </oasis:entry>
       </oasis:row>
       <oasis:row rowsep="1">
         <oasis:entry colname="col1"/>
         <oasis:entry colname="col2">M1</oasis:entry>
         <oasis:entry colname="col3">Pacific</oasis:entry>
         <oasis:entry colname="col4">M1</oasis:entry>
         <oasis:entry colname="col5">Pacific</oasis:entry>
         <oasis:entry colname="col6">M1</oasis:entry>
         <oasis:entry colname="col7">Pacific</oasis:entry>
         <oasis:entry colname="col8">M1</oasis:entry>
         <oasis:entry colname="col9">Pacific</oasis:entry>
         <oasis:entry colname="col10">M1</oasis:entry>
         <oasis:entry colname="col11">Pacific</oasis:entry>
       </oasis:row>
     </oasis:thead>
     <oasis:tbody>
       <oasis:row>
         <oasis:entry colname="col1">Avg. reads</oasis:entry>
         <oasis:entry colname="col2">78 140</oasis:entry>
         <oasis:entry colname="col3">74 279</oasis:entry>
         <oasis:entry colname="col4">125 809</oasis:entry>
         <oasis:entry colname="col5">94 150</oasis:entry>
         <oasis:entry colname="col6">13 236</oasis:entry>
         <oasis:entry colname="col7">13 939</oasis:entry>
         <oasis:entry colname="col8">9131</oasis:entry>
         <oasis:entry colname="col9">21 092</oasis:entry>
         <oasis:entry colname="col10">203 083</oasis:entry>
         <oasis:entry colname="col11">187 646</oasis:entry>
       </oasis:row>
       <oasis:row>
         <oasis:entry colname="col1">(SD)</oasis:entry>
         <oasis:entry colname="col2">22 681</oasis:entry>
         <oasis:entry colname="col3">6018</oasis:entry>
         <oasis:entry colname="col4">26 365</oasis:entry>
         <oasis:entry colname="col5">19 034</oasis:entry>
         <oasis:entry colname="col6">9080</oasis:entry>
         <oasis:entry colname="col7">6052</oasis:entry>
         <oasis:entry colname="col8">6511</oasis:entry>
         <oasis:entry colname="col9">10 738</oasis:entry>
         <oasis:entry colname="col10">20 875</oasis:entry>
         <oasis:entry colname="col11">36 331</oasis:entry>
       </oasis:row>
       <oasis:row>
         <oasis:entry colname="col1">ASVs</oasis:entry>
         <oasis:entry colname="col2">1720</oasis:entry>
         <oasis:entry colname="col3">1890</oasis:entry>
         <oasis:entry colname="col4">2105</oasis:entry>
         <oasis:entry colname="col5">2825</oasis:entry>
         <oasis:entry colname="col6">360</oasis:entry>
         <oasis:entry colname="col7">265</oasis:entry>
         <oasis:entry colname="col8">158</oasis:entry>
         <oasis:entry colname="col9">203</oasis:entry>
         <oasis:entry colname="col10">3223</oasis:entry>
         <oasis:entry colname="col11">4139</oasis:entry>
       </oasis:row>
       <oasis:row>
         <oasis:entry colname="col1">Phyla</oasis:entry>
         <oasis:entry colname="col2">25</oasis:entry>
         <oasis:entry colname="col3">28</oasis:entry>
         <oasis:entry colname="col4">29</oasis:entry>
         <oasis:entry colname="col5">39</oasis:entry>
         <oasis:entry colname="col6">2</oasis:entry>
         <oasis:entry colname="col7">4</oasis:entry>
         <oasis:entry colname="col8">5</oasis:entry>
         <oasis:entry colname="col9">7</oasis:entry>
         <oasis:entry colname="col10">24</oasis:entry>
         <oasis:entry colname="col11">38</oasis:entry>
       </oasis:row>
       <oasis:row>
         <oasis:entry colname="col1">Classes</oasis:entry>
         <oasis:entry colname="col2">54</oasis:entry>
         <oasis:entry colname="col3">59</oasis:entry>
         <oasis:entry colname="col4">71</oasis:entry>
         <oasis:entry colname="col5">84</oasis:entry>
         <oasis:entry colname="col6">5</oasis:entry>
         <oasis:entry colname="col7">8</oasis:entry>
         <oasis:entry colname="col8">13</oasis:entry>
         <oasis:entry colname="col9">13</oasis:entry>
         <oasis:entry colname="col10">43</oasis:entry>
         <oasis:entry colname="col11">72</oasis:entry>
       </oasis:row>
       <oasis:row>
         <oasis:entry colname="col1">Orders</oasis:entry>
         <oasis:entry colname="col2">104</oasis:entry>
         <oasis:entry colname="col3">117</oasis:entry>
         <oasis:entry colname="col4">143</oasis:entry>
         <oasis:entry colname="col5">176</oasis:entry>
         <oasis:entry colname="col6">18</oasis:entry>
         <oasis:entry colname="col7">24</oasis:entry>
         <oasis:entry colname="col8">15</oasis:entry>
         <oasis:entry colname="col9">16</oasis:entry>
         <oasis:entry colname="col10">130</oasis:entry>
         <oasis:entry colname="col11">166</oasis:entry>
       </oasis:row>
       <oasis:row>
         <oasis:entry colname="col1">Families</oasis:entry>
         <oasis:entry colname="col2">141</oasis:entry>
         <oasis:entry colname="col3">168</oasis:entry>
         <oasis:entry colname="col4">193</oasis:entry>
         <oasis:entry colname="col5">229</oasis:entry>
         <oasis:entry colname="col6">25</oasis:entry>
         <oasis:entry colname="col7">32</oasis:entry>
         <oasis:entry colname="col8">14</oasis:entry>
         <oasis:entry colname="col9">15</oasis:entry>
         <oasis:entry colname="col10">183</oasis:entry>
         <oasis:entry colname="col11">242</oasis:entry>
       </oasis:row>
       <oasis:row>
         <oasis:entry colname="col1">Genera</oasis:entry>
         <oasis:entry colname="col2">45</oasis:entry>
         <oasis:entry colname="col3">57</oasis:entry>
         <oasis:entry colname="col4">214</oasis:entry>
         <oasis:entry colname="col5">242</oasis:entry>
         <oasis:entry colname="col6">24</oasis:entry>
         <oasis:entry colname="col7">27</oasis:entry>
         <oasis:entry colname="col8">2</oasis:entry>
         <oasis:entry colname="col9">4</oasis:entry>
         <oasis:entry colname="col10">348</oasis:entry>
         <oasis:entry colname="col11">414</oasis:entry>
       </oasis:row>
       <oasis:row>
         <oasis:entry colname="col1">Species</oasis:entry>
         <oasis:entry colname="col2">37</oasis:entry>
         <oasis:entry colname="col3">48</oasis:entry>
         <oasis:entry colname="col4">197</oasis:entry>
         <oasis:entry colname="col5">234</oasis:entry>
         <oasis:entry colname="col6">21</oasis:entry>
         <oasis:entry colname="col7">21</oasis:entry>
         <oasis:entry colname="col8">2</oasis:entry>
         <oasis:entry colname="col9">5</oasis:entry>
         <oasis:entry colname="col10">10</oasis:entry>
         <oasis:entry colname="col11">8</oasis:entry>
       </oasis:row>
     </oasis:tbody>
   </oasis:tgroup></oasis:table><?xmltex \gdef\@currentlabel{1}?></table-wrap>

</sec>
<sec id="Ch1.S3.SS3">
  <label>3.3</label><title>Results of principal component analysis</title>
<sec id="Ch1.S3.SS3.SSS1">
  <label>3.3.1</label><title>RPCA and PERMANOVA</title>
      <p id="d1e2495">The first principal component of COI, 18S rRNA, V1–V2 16S rRNA plastidial
ASVs, and V1–V2 16S rRNA bacterial ASVs revealed a swift divergence between
the Pacific and mesocosm communities (Fig. 3). In the COI, 18S rRNA, and 16S
rRNA plastidial sequences (Fig. 3a, b, and c), this divergence is
first seen on day 15, with the first eDNA sample taken after the OMZ water and
salt additions. In the 16S rRNA bacterial sequences (Fig. 3d), this
divergence is already seen on day 8, prior to additions. A PERMANOVA test
revealed a significant difference between M1 samples following additions and
the other samples, confirming the significance of the observed divergence
(COI: <inline-formula><mml:math id="M155" display="inline"><mml:mrow><mml:mi>p</mml:mi><mml:mo>=</mml:mo><mml:mn mathvariant="normal">0.001</mml:mn></mml:mrow></mml:math></inline-formula>, <inline-formula><mml:math id="M156" display="inline"><mml:mi>F</mml:mi></mml:math></inline-formula> statistic <inline-formula><mml:math id="M157" display="inline"><mml:mo>=</mml:mo></mml:math></inline-formula> 11.78; 18S rRNA: <inline-formula><mml:math id="M158" display="inline"><mml:mrow><mml:mi>p</mml:mi><mml:mo>=</mml:mo><mml:mn mathvariant="normal">0.001</mml:mn></mml:mrow></mml:math></inline-formula>, <inline-formula><mml:math id="M159" display="inline"><mml:mi>F</mml:mi></mml:math></inline-formula> statistic <inline-formula><mml:math id="M160" display="inline"><mml:mo>=</mml:mo></mml:math></inline-formula> 11.76; 16S rRNA chloroplast: <inline-formula><mml:math id="M161" display="inline"><mml:mrow><mml:mi>p</mml:mi><mml:mo>=</mml:mo><mml:mn mathvariant="normal">0.002</mml:mn></mml:mrow></mml:math></inline-formula>, <inline-formula><mml:math id="M162" display="inline"><mml:mi>F</mml:mi></mml:math></inline-formula> statistic <inline-formula><mml:math id="M163" display="inline"><mml:mo>=</mml:mo></mml:math></inline-formula> 7.20; 16S rRNA
bacterial: <inline-formula><mml:math id="M164" display="inline"><mml:mrow><mml:mi>p</mml:mi><mml:mo>=</mml:mo><mml:mn mathvariant="normal">0.001</mml:mn></mml:mrow></mml:math></inline-formula>, <inline-formula><mml:math id="M165" display="inline"><mml:mi>F</mml:mi></mml:math></inline-formula> statistic <inline-formula><mml:math id="M166" display="inline"><mml:mo>=</mml:mo></mml:math></inline-formula> 10.11). Following this initial
divergence, the M1 samples continue to separate from the Pacific samples.
The Pacific samples show a slight temporal trend on PC2 across all four
datasets. As shown by the proportion of variance explained by each principal
component, the degree of divergence between M1 and the Pacific is greater
than the degree of change experienced by the Pacific.</p>
</sec>
<sec id="Ch1.S3.SS3.SSS2">
  <label>3.3.2</label><title>Mesocosm-associated ASVs and taxonomy revealed by PC1 loading scores</title>
      <p id="d1e2612">The taxa that had the highest positive PC1 loading scores, and thus were
associated with M1, included various photo-, mixo-, and heterotrophic taxa.
For the COI data, this included the dinoflagellate <italic>Akashiwo sanguinea</italic>. Unassigned ASVs made up
six of the other mesocosm-associated ASVs for COI, while other
mesocosm-associated ASVs included two assigned to the red algae family
Bangiaceae, one to the heterotrophic nanoflagellate family Cafeteriaceae,
three to the haptophyte family Chrysochromulinaceae, one to the diatom
<italic>Skeletonema</italic>, and one to the prasinophyte family Pycnococcaceae (Class V prasinophytes;
Bachy et al., 2022).</p>
      <p id="d1e2621">The mesocosm-associated 18S rRNA ASVs were dominated by dinoflagellates,
which were 9 of the top 15 positive loading ASVs. The six other ASVs in the
top 15 mesocosm-associated ASVs included one ASV assigned to the cercozoan
genus <italic>Protaspis</italic>, another ASV assigned to the cryptophyte species <italic>Geminigera cryophila</italic>, and four
unassigned ASVs.</p>
      <p id="d1e2630">In the V1–V2 16S rRNA plastidial sequences, mesocosm-associated ASVs
included four ASVs assigned to the cryptophyte order Pyrenomonadales, six
diatom ASVs, an ASV assigned to the class Embryophyceae (land plants), two
ASVs assigned to the silicoflagellates (class Dictyochophyceae), an ASV
assigned to the family Chrysochromulinaceae, and an unassigned ASV. In the
V1–V2 16S rRNA bacterial sequences, nine ASVs were assigned to the phylum
Proteobacteria, four to the phylum Bacteroidetes, and one each to the phyla
Patescibacteria and Verrucomicrobia.</p>
</sec>
<sec id="Ch1.S3.SS3.SSS3">
  <label>3.3.3</label><title>Pacific ASVs and taxonomy revealed by PC1 loading scores</title>
      <p id="d1e2641">Pacific COI ASVs included three mesozooplankton ASVs, two assigned to the
rotifer family Synchaetidae and one assigned to the calanoid copepod family
Acartiidae. In the phytoplankton portion of the COI Pacific-associated ASVs,
the coccolithophore <italic>Emiliania huxleyi</italic> figured prominently, comprising five of the top 15
Pacific-associated ASVs. The diatom family Stephanodiscaceae was also
determined to be associated with the Pacific. Of the COI ASVs associated
with the Pacific that were not mesozooplankton or phytoplankton, one ASV
belonged to the amoeboid family Paulinellidae (phylum Cercozoa), one was
assigned to the amoebozoan family Vexilliferidae, one was assigned to the
oomycete family Saprolegniaceae, and three ASVs were unassigned.</p>
      <p id="d1e2647">Pacific 18S rRNA ASVs were dominated by diatom ASVs, which made up 9 of the
top 15 Pacific-associated ASVs. All of these diatom ASVs were annotated to
the genus- or species-level, and included the genera <italic>Skeletonema</italic>, <italic>Amphora</italic>, <italic>Thalassiosira</italic>, <italic>Cyclotella</italic>,
<italic>Leptocylindrus</italic>, and <italic>Chaetoceros</italic>. Three of the top 15 Pacific ASVs were dinoflagellate ASVs, two
of which were annotated to the order Syndiniales, with one of these ASVs
annotated to the family Duboscquellidae within the Syndiniales; the other
dinoflagellate ASV was annotated to the family Gymnodiniaceae. One other ASV
was assigned to the tintinnid ciliate species <italic>Eutintinnus</italic>  cf. <italic>apertus</italic>, and two other ASVs were
unassigned.</p>
      <p id="d1e2675">The Pacific V1–V2 16S rRNA plastidial ASVs were dominated by diatoms, which
represented 13 of the top 15 Pacific-associated ASVs. Of the two other
Pacific-associated chloroplast-derived ASVs, one was assigned to the
chlorophyte family Chlorellaceae and the other to the class Dictyochophyceae
(silicoflagellates). Among the 16S rRNA bacterial ASVs, the top 15 contained
six assigned to the phylum Bacteroidetes, three each assigned to the<?pagebreak page1286?> phyla
Proteobacteria and Actinobacteria and one each assigned to the phyla
Marinimicrobia, Verrucomicrobia, and Cyanobacteria. Surprisingly, the
cyanobacterial ASV is identical to a <italic>Cyanobium</italic> sp. strain, Suigetsu-CR5, isolated
from a Japanese saline lake (Ohki et al.,
2012), while further analysis of other, less abundant cyanobacterial ASVs
identified more typical marine <italic>Synechococcus</italic> strains (see Supplement).</p>

      <?xmltex \floatpos{t}?><fig id="Ch1.F4"><?xmltex \currentcnt{4}?><?xmltex \def\figurename{Figure}?><label>Figure 4</label><caption><p id="d1e2687">The 12S rRNA results, showing top 10 genera (or families, for ASVs
that were not annotated to the genus level) for <bold>(a)</bold> the Pacific and <bold>(b)</bold> the
mesocosm samples, by total number of reads. Detections of <italic>Larosterna inca</italic> and <italic>Pelecanus occidentalis</italic> are indicated
by the symbols in <bold>(b)</bold>. All reads of <italic>Paralichthys</italic> have been removed from <bold>(a)</bold> and <bold>(b)</bold>. Panel <bold>(c)</bold> shows the total number of reads of <italic>Paralichthys</italic>, the genus of the fish eggs
(<italic>Paralichthys adspersus</italic>) that were added to the mesocosm on day 31. Because there is no available
reference sequence for <italic>Paralichthys adspersus</italic>, genus-level annotations are used to assess the
detections of this species using eDNA.</p></caption>
            <?xmltex \igopts{width=236.157874pt}?><graphic xlink:href="https://bg.copernicus.org/articles/20/1277/2023/bg-20-1277-2023-f04.png"/>

          </fig>

</sec>
</sec>
<sec id="Ch1.S3.SS4">
  <label>3.4</label><title>Vertebrate detection</title>
      <p id="d1e2743">The 12S rRNA detected a diversity of vertebrate taxa in the Pacific, dominated
by anchovy (genus <italic>Engraulis</italic>) (Fig. 4a), and with fluctuating numbers of reads. In
contrast, the mesocosm showed an initial high number of reads, similarly
dominated by anchovy, followed by a drastic drop in reads in the second and
third samples (taken on days 8 and 15), which had only 10 and 37 vertebrate
reads, respectively (Fig. 4b). The number of vertebrate reads in the
mesocosm then increased on day 24 due to reads assigned to the family
Sciaenidae (drums and croakers), and subsequently an increase in anchovy
reads was also observed. In Fig. 4c, reads assigned to the genus
<italic>Paralichthys</italic> appear on days 32 and 36 following the addition of eggs of fine flounder
<italic>Paralichthys adspersus</italic> on day 31, but are absent in all other samples. Other taxa of note that were
detected by 12S rRNA but are not pictured in the above plots because they
did not meet the abundance threshold to be included were Inca tern
<italic>Larosterna inca</italic> (six reads each in the mesocosm on days 42 and 48) and brown pelican
<italic>Pelecanus occidentalis</italic> (159 reads in the mesocosm on day 36); the detection of these species is
indicated by the corresponding symbols above the bars in Fig. 4b.</p><?xmltex \hack{\newpage}?>
</sec>
</sec>
<sec id="Ch1.S4" sec-type="conclusions">
  <label>4</label><title>Discussion</title>
      <p id="d1e2771">The Peruvian eastern boundary upwelling system is known for its dynamic nature
(Penven
et al., 2005; Huyer et al., 1991; Echevin et al., 2004), reflected by the
physicochemical (warming shift, NO<inline-formula><mml:math id="M167" display="inline"><mml:mrow><mml:msubsup><mml:mi/><mml:mi>x</mml:mi><mml:mo>-</mml:mo></mml:msubsup></mml:mrow></mml:math></inline-formula> fluctuations) and ecological
(Fig. 3) changes observed in the unenclosed Pacific ocean over our 50 d
sampling period. The variability observed in the Pacific during the sampling
period is contrasted by the large shift from these upwelling conditions in
the mesocosm, which was isolated from the surrounding Pacific and stratified
by NaCl brine injections. This resulted in reduced horizontal and vertical
mixing, leading to depletion of nutrients (Fig. 2); NO<inline-formula><mml:math id="M168" display="inline"><mml:mrow><mml:msubsup><mml:mi/><mml:mi>x</mml:mi><mml:mo>-</mml:mo></mml:msubsup></mml:mrow></mml:math></inline-formula> (Fig. 2c)
in particular exhibited a quick and continuous decline, reaching the
threshold of detection by day 20. This is in stark contrast to the
concentration of NO<inline-formula><mml:math id="M169" display="inline"><mml:mrow><mml:msubsup><mml:mi/><mml:mi>x</mml:mi><mml:mo>-</mml:mo></mml:msubsup></mml:mrow></mml:math></inline-formula> in the Pacific, which varied from 2.7–19.2 <inline-formula><mml:math id="M170" display="inline"><mml:mrow class="unit"><mml:mi mathvariant="normal">µ</mml:mi></mml:mrow></mml:math></inline-formula>mol L<inline-formula><mml:math id="M171" display="inline"><mml:msup><mml:mi/><mml:mrow><mml:mo>-</mml:mo><mml:mn mathvariant="normal">1</mml:mn></mml:mrow></mml:msup></mml:math></inline-formula>. The observed high concentrations and high
day-to-day variability of nitrogen in the natural Pacific samples was
indicative of intermittent upwelling, whereby nutrients in the surface
waters are replenished from below
(Chavez and Messie, 2009; Graco et
al., 2017). Si(OH)<inline-formula><mml:math id="M172" display="inline"><mml:msub><mml:mi/><mml:mn mathvariant="normal">4</mml:mn></mml:msub></mml:math></inline-formula> (Fig. 2d) is also lower in the mesocosm and
declined in concentration throughout (except for when OMZ water, rich in
Si(OH)<inline-formula><mml:math id="M173" display="inline"><mml:msub><mml:mi/><mml:mn mathvariant="normal">4</mml:mn></mml:msub></mml:math></inline-formula>, was injected) but never reached levels below 3.4 <inline-formula><mml:math id="M174" display="inline"><mml:mrow class="unit"><mml:mi mathvariant="normal">µ</mml:mi></mml:mrow></mml:math></inline-formula>mol L<inline-formula><mml:math id="M175" display="inline"><mml:msup><mml:mi/><mml:mrow><mml:mo>-</mml:mo><mml:mn mathvariant="normal">1</mml:mn></mml:mrow></mml:msup></mml:math></inline-formula>.</p>
      <p id="d1e2869">The differences in physical and biogeochemical conditions between the
Pacific and the eight mesocosms were pronounced. These physical and chemical
differences are reflected in the eDNA metabarcoding comparisons of diversity
and the taxonomic composition of the biological communities in the unenclosed
Pacific Ocean and one of the mesocosms (M1). The communities responded in a
somewhat predictable manner, with those in the Pacific being characteristic
of higher-nutrient upwelling conditions and those in the mesocosms being
characteristic of lower-nutrient stratified conditions.</p>
<?pagebreak page1287?><sec id="Ch1.S4.SS1">
  <label>4.1</label><title>Phytoplankton communities</title>
      <p id="d1e2879">Phytoplankton are strongly linked to changes in abiotic conditions in
upwelling systems, and the connection between environmental conditions and
phytoplankton was reflected in the differing communities of the mesocosm and
Pacific. Upwelling conditions, as were observed in the Pacific during the
experiment, are associated with increased nutrient availability and
turbulence (Chavez and
Messié, 2009), favoring fast growing non-motile phytoplankton such as
diatoms (Margalef, 1978) and newly discovered prasinophyte
species (see, e.g.,
Worden
et al., 2004; Simmons et al., 2016). Conversely, relaxing upwelling
conditions and subsequent stratification (as were observed in the mesocosm)
result in reduced mixing and exhaustion of nutrients (nitrate) in the
surface layer. These conditions favor motile organisms like dinoflagellates,
who are able to vertically migrate to the deeper nutrient-rich layer at
night and back to the surface during the day without the hindrance of
turbulence
(Margalef,
1978; Smayda, 2010; Smayda and Trainer, 2010).</p>
      <p id="d1e2882">The stratified mesocosm was dominated by the mixotrophic dinoflagellate
<italic>Akashiwo sanguinea</italic>, a signature bloom species in EBUS
(Trainer
et al., 2010; Bach et al., 2020). <italic>A. sanguinea</italic> ASVs were found to be strongly
mesocosm-associated in both the COI and 18S rRNA datasets (Fig. 4e and f),
and in the 18S rRNA sequences in particular, <italic>A. sanguinea</italic> was dominant in the mesocosm in
the later stages of the experiment, comprising over 50 % of the reads in
some samples (Fig. S3). <italic>A. sanguinea</italic> reads were a minor proportion of the reads in the
COI dataset and absent from the 16S rRNA plastid sequences; the disparity in
the detection of <italic>A. sanguinea</italic> by our different PCR primers can be explained by
inefficient dinoflagellate amplification by COI primers
(Lin et al., 2009) and the loss of most
chloroplast genes from dinoflagellates
(Koumandou et al., 2004), causing them not to
be detected in our 16S rRNA plastidial sequences
(Needham and Fuhrman, 2016). While the
correlation between cell biomass and amplicon sequence abundance is
complicated both by technical biases in metabarcoding and variation in gene
copy numbers (Martin et al.,
2022), the high biomass of certain taxa as inferred using read numbers is
corroborated by other sampling techniques used to sample community
composition. In this experiment, <italic>A. sanguinea</italic> was also identified as the dominant
dinoflagellate by imaging flow cytometry and microscopy in mesocosm M1 and
in seven of eight mesocosms overall
(Bach et al., 2020). Bach et al. (2020) report the common diurnal migration pattern of dinoflagellates, at
the surface during the day, migrating to the nutricline at night to take up
nutrients. Mixotrophy and vertical migration allow <italic>A. sanguinea</italic> to exploit nutrients
found below the nutrient-depleted surface layer, especially when there is a
shallow thermocline (Kudela et al.,
2010), as was the case in the mesocosm in this experiment (Fig. 3a in Bach
et al., 2020). Blooms of <italic>A. sanguinea</italic> are regularly observed in EBUS
(Du
et al., 2011; Kudela et al., 2008; Kahru et al., 2004; Dugdale et al., 1977)
under shallow thermocline stratified conditions, following upwelling
relaxation. <italic>A. sanguinea</italic> is typically not found in EBUS phytoplankton communities
outside these specific conditions
(Kolody
et al., 2019; Limardo et al., 2017). Hence, the mesocosm experiment provided
the right environmental conditions to initiate a dinoflagellate bloom from
the propagules inside the mesocosm, which were either already present in the
enclosed water or introduced from the OMZ water additions.</p>
      <p id="d1e2913">In addition to <italic>A sanguinea</italic>, many other dinoflagellate ASVs were found to be
mesocosm-associated. These dinoflagellate ASVs included the mixotrophic
dinoflagellate <italic>Fragilidium duplocampanaeforme</italic> and its prey, the genus <italic>Dinophysis</italic>
(Park and Kim, 2010). A
heterotrophic<?pagebreak page1288?> dinoflagellate known to feed on bloom-forming dinoflagellates,
<italic>Polykrikos kofoidii</italic> (Matsuyama et al., 1999;
Tillmann, 2004), was also detected to be mesocosm-associated.
Dinoflagellates comprised about two-thirds of the top organisms in our 18S
rRNA PC loadings analysis (Fig. 3f), indicating a strong selection of these
organisms under stratified conditions and interesting predator–prey
relationships. Other mesocosm-associated ASVs included ones annotated to the
family Chrysochromulinaceae in the COI and V1–V2 16S rRNA plastidial
datasets, which also likely reflect stratification, as blooms of
<italic>Chrysochromulina</italic> have previously been reported in strongly stratified, stable conditions
(Edvarsen and Paasche, 1998). Multiple ASVs assigned to the
cryptophyte order Pyrenomonadales were found to be mesocosm-associated in
the 18S rRNA and V1–V2 16S rRNA plastidial datasets; this could be connected
to their green light harvesting phycobiliproteins, which appear to
facilitate their growth in low-light conditions
(Spear-Bernstein and Miller, 1989), as
were found in the mesocosms (Fig. 3c in Bach et al., 2020). However, some
Pyrenomondales are predatory mixotrophs; thus, changes in relative abundance
could also connect to changes in the bacterial community that provisioned
prey resources.</p>
      <p id="d1e2931">In contrast, the phytoplankton community of the coastal Pacific ocean was
dominated by diatoms, typical of communities during higher-nutrient
upwelling conditions
(Pennington et al.,
2006; Chavez et al., 2017; Choi et al., 2020) as well as the cosmopolitan
coccolithophore <italic>Emiliania huxleyi</italic>. As seen by the high levels of NO<inline-formula><mml:math id="M176" display="inline"><mml:mrow><mml:msubsup><mml:mi/><mml:mi>x</mml:mi><mml:mo>-</mml:mo></mml:msubsup></mml:mrow></mml:math></inline-formula> in the
Pacific (Fig. 2c), upwelling conditions were maintained during the period of
study, favoring <inline-formula><mml:math id="M177" display="inline"><mml:mi>r</mml:mi></mml:math></inline-formula>-selected species like diatoms and maintaining an early
succession community (Margalef, 1978; Tyrrell and
Merico, 2004). The presence of coccolithophores is indicative of the mixing
of some open ocean waters that had come closer to shore due to the coastal
El Niño. Although Class II prasinophytes (Mamiellophyceae) were detected
in the 16S amplicon data (Fig. S3), they were present at lower relative
abundances than the above groups. This is different from observations of
prasinophyte importance in more mesotrophic water columns in EBUS off
California, USA
(Limardo
et al., 2017; Kolody et al., 2019; Choi et al., 2020) and off the coast of
Chile (De la Iglesia et al., 2020). In the
mesocosm, the low levels of nutrients in the mixed layer resulted in lower
diatom growth rates, and they sank due to increased stratification
(Smayda and Trainer, 2010). Some diatom
ASVs remained prevalent in the mesocosm, particularly ASVs assigned to the
family Skeletonemataceae (Fig. S3), perhaps as seed populations ready to
exploit a change in the environment. In the latter part of the experiment
they may also have been seeded by the seabird faeces, given the increased
presence of birds in the local area. Diatoms are ubiquitous in anchovy
stomachs (Espinoza and Bertrand, 2008),
and anchovies are favored by seabirds (Duffy, 1983), and both
anchovy and seabird eDNA appeared later in the mesocosm.</p>
      <p id="d1e2957">There were also three dinoflagellate ASVs common in the Pacific. While one
of these was assigned to the family Gymnodiniaceae, a broad family of
free-living dinoflagellates, the other two were both assigned to the
Syndiniales, a parasitic order
(Guillou et al., 2008).
Among these two ASVs, one was annotated to the family Duboscquellidae, with
some species within this family known to parasitize the tintinnid ciliate
<italic>Eutintinnus</italic> (Coats, 1988). The ciliate <italic>Eutintinnus</italic> has also been documented to form
symbiotic relationships with multiple diatom species
(Gómez, 2007, 2020; Vincent et
al., 2018). Interestingly, an ASV assigned to the genus <italic>Eutintinnus</italic> was also found in
the Pacific, suggesting that both the parasite–host relationship and the
symbiotic relationship of this ciliate was found in the ocean surrounding
the mesocosms.</p>
      <p id="d1e2969">An unusual and abundant ASV identical to <italic>Cyanobium</italic> sp. Suigetsu-CR5
(Ohki et al., 2012) was found in the
coastal Pacific samples. The primers used to amplify 16S rRNA did not
provide full-length 16S rRNA gene sequences to confirm that this ASV was the
same organism as that isolated from a Japanese lake. However, <italic>Cyanobium</italic> sp.
Suigetsu-CR5-like sequences have been reported from the open ocean
northeastern Pacific (Sudek et al.,
2015). Taken together, these results suggest that a marine <italic>Cyanobium</italic> sp.
Suigetsu-CR5-like organism exists and given the right environmental
conditions can become a dominant cyanobacterium.</p>
</sec>
<sec id="Ch1.S4.SS2">
  <label>4.2</label><title>Zooplankton communities</title>
      <p id="d1e2989">The mesozooplankton communities of the mesocosm and Pacific as detected via
COI were differentiated primarily by Pacific-associated ASVs assigned to the
rotifer family Synchaetidae and the calanoid copepod family Acartiidae (Fig. 3e); these results are in agreement with vertical tows of an Apstein net of
mesh size 100 <inline-formula><mml:math id="M178" display="inline"><mml:mrow class="unit"><mml:mi mathvariant="normal">µ</mml:mi></mml:mrow></mml:math></inline-formula>m during the experiment (unpublished data). Rotifers
were detected initially in similar abundance in both the mesocosm and the
Pacific in the COI data, but declined in abundance in the mesocosm while
remaining more abundant, albeit highly variable, in the Pacific (Fig. S3b).
Conversely, ASVs assigned to the copepod family Acartiidae were more
abundant in the Pacific than the mesocosm from the start of the experiment
in both the net tow and COI data (unpublished data, Fig. S3b), indicating
that fewer individuals of this family were trapped within the mesocosm when
it was closed, owing to the patchy distribution of zooplankton
(Wiebe and Holland, 1968). The most dominant zooplankton
taxa found were the calanoid copepod <italic>Paracalanus</italic> (detected by COI and 18S) and the
cyclopoid copepod <italic>Hemicyclops</italic> (detected only by 18S); however, these taxa were found in
similar abundances in both the mesocosm and Pacific samples throughout the
experiment by both eDNA metabarcoding and net tow data and thus did not
differentiate the two sampling sites (Fig. S3b and  c). Copepods<?pagebreak page1289?> have
lifespans that are greater than the duration of the experiment
(Ianora, 1998), so a significant response of the
copepod communities was not captured within the mesocosm relative to the
Pacific. Longer-term experiments will be required to study responses of
animals with generation times of months or greater.</p>
      <p id="d1e3006">The nanozooplankton community of the mesocosm was separated from that of the
Pacific by the higher relative abundance of the family Cafeteriaceae, the
higher relative abundance of the cercozoan genus <italic>Protaspis</italic>, and the relative lower
abundance of the families Paulinellidae and Vexilliferidae. The family
Cafeteriaceae is a made up of heterotrophic nanoflagellates, many of which
are filter-feeding bacterivores
(Schoenle et al.,
2020). Their increased abundance in the mesocosm may reflect their tendency
to associate with detritus (Patterson et
al., 1993) or adhere to structure
(Baker et
al., 2018; Boenigk and Arndt, 2000), as was available in the mesocosm. The
amoebozoan family Vexilliferidae is ubiquitous in both marine and estuarine
environments (Page, 1983), while the amoeboid family Paulinellidae
(phylum Cercozoa) contains phototrophic and heterotrophic species which
inhabit freshwater, brackish, and marine environments
(Kim and Park, 2016).</p>
</sec>
<sec id="Ch1.S4.SS3">
  <label>4.3</label><title>Heterotrophic and photosynthetic bacterial community</title>
      <p id="d1e3021">As seen in the beta diversity analyses in Fig. 3, the bacterial community of
the mesocosm diverged from that of the Pacific faster than the communities
detected by COI, 18S rRNA, and 16S plastidial sequences, separating on PC1
by day 8 rather than day 15. This may be at least partially explained by the
fast growth rate of prokaryotic cells (Zubkov, 2014). The
ASVs that were Pacific-associated were representative of typical coastal,
phytoplankton-rich communities
(Needham and Fuhrman, 2016;
Buchan et al., 2014). These ASVs included an ASV assigned to the 16S rRNA
clade SAR86, one of the most abundant constituents of microbial communities
in the surface ocean (Dupont et al.,
2012), and an ASV assigned to the family Synechococcaceae, a ubiquitous
family of cyanobacteria that is most abundant in nutrient-rich surface
waters (Partensky et al., 1999), as was found in the
Pacific during the course of the experiment (Fig. 2). Mesocosm-associated
ASVs included the methylotrophic family Methylophagaceae
(Neufeld et al., 2007),
<italic>Pseudohongiella</italic>, a genus recently isolated from the northwest Pacific
(Xu
et al., 2016; Park et al., 2014), multiple ASVs of the family
Rhodobacteraceae, and an ASV assigned to the NS5 marine group.
Rhodobacteraceae have previously been documented to increase in response to
a bloom of <italic>A. sanguinea</italic> (Yang et al., 2012), as
was documented within the mesocosm, and have also been documented to
increase in blooms of the harmful dinoflagellate <italic>Alexandrium</italic>
(Hattenrath-Lehmann and Gobler,
2017). Similarly, the NS5 marine group has previously been documented to
have increased in abundance with blooms of both <italic>A. sanguinea</italic>
(Yang et al., 2015) and <italic>Alexandrium</italic>
(Hattenrath-Lehmann and Gobler,
2017).</p>
      <p id="d1e3039">One of the most unusual taxa that was detected was from the order
Saccharimonadales within the superphylum <italic>Cand.</italic> Patescibacteria
(Parks et al., 2018), which was first detected in M1
on day 15 and in the Pacific on day 24 and subsequently increased in
abundance in both M1 and the Pacific. The rise corresponded with an increase
in small bacteria and heterotrophic bacteria overall in flow cytometry
samples. While this group (Saccharibacteria) has been detected in seawater
previously (Hugenholtz et al.,
2001) and is commonly found across many different environments from soil to
the human gut and oral microbiomes
(Kuehbacher
et al., 2008; Marcy et al., 2007; Ferrari et al., 2005), some
representatives of this group have an unusual symbiotic lifestyle. They were
recently isolated from the human oral microbiome where they were found to be
epibionts of Actinobacteria (He et
al., 2015). Recent genomic evidence reveals that Saccharibacteria have small
genomes (<inline-formula><mml:math id="M179" display="inline"><mml:mrow><mml:mi mathvariant="italic">&lt;</mml:mi><mml:mn mathvariant="normal">1</mml:mn></mml:mrow></mml:math></inline-formula> Mb), with genomic contents consistent with a symbiotic
lifestyle (Lemos et al., 2019), and
microscopy and filter size fractionation have found them to be very small
cells (or “ultra-small bacteria”). To account for their rapid rise in
prevalence, it is possible that these Saccharibacteria colonized the
mesocosms via a biofilm (outside and inside the experiment itself) or were
introduced via seabird faeces, as Saccharibacteria have previously been
detected in the avian microbiome (Hird et
al., 2015). The timing of the increase is consistent with the appearance of
the seabirds on the mesocosms. Since the seabirds were foraging in the
vicinity of the mesocosms, it is possible that they may have contributed to
the increase in the Pacific samples as well. In any case, this observation
warrants further study to understand the lifestyle and genomic potential of
this enigmatic group.</p>
</sec>
<sec id="Ch1.S4.SS4">
  <label>4.4</label><title>Insights into vertebrates</title>
      <p id="d1e3063">The 12S rRNA metabarcoding data detected distinctly different communities in
the Pacific and in the mesocosm. Bony fish typical of the coastal Peruvian
upwelling system, dominated by the Peruvian anchoveta (<italic>Engraulis ringens</italic>), were found in the
Pacific samples. In the mesocosm, the species assemblage reflected three
experimental perturbations: (1) the exclusion of vertebrates via a 3 mm mesh,
(2) the addition of eggs of <italic>Paralichthys adspersus</italic>, and (3) the impact of resting seabirds. During
the deployment of the mesocosm, the initial water was filtered through a net
of mesh size 3 mm, and collection of the OMZ water that was later added was
conducted through a net of mesh size 10 mm. The fine mesh sizes effectively
excluded most, if not all, living vertebrate stages from the enclosure but
not their eDNA. The initial vertebrate eDNA in the mesocosm decayed rapidly,
as evidenced by the extremely low read counts on days 8 and 15 (10 and 37
vertebrate reads, respectively).<?pagebreak page1290?> The virtual disappearance of vertebrate
eDNA a week after the start of the experiment is in line with estimates of
bony fish eDNA decay rates
(Sassoubre et al., 2016), which
show an exponential decline in eDNA concentrations with time. Quantification
of eDNA decay rates of northern anchovy (<italic>Engraulis mordax</italic>), which is congeneric with the
Peruvian anchoveta <italic>E. ringens</italic>, showed that <italic>E. mordax</italic> DNA concentration reached the threshold of
detection by a qPCR assay within three days of the fish being removed from
the enclosure (Sassoubre et al.,
2016). There may have been some eDNA introduced by the addition of the OMZ
water; however, the 10-day period between when this water was collected on
day 5 and when the first eDNA sampling occurred following OMZ water addition
(day 15) coupled with the decay rate of eDNA makes the detection of this
eDNA unlikely.</p>
      <p id="d1e3081">The addition of eggs of the fish <italic>Paralichthys adspersus</italic> (fine flounder) to the mesocosm on day
31 led to a notable spike in <italic>Paralichthys</italic> reads on days 32 and 36; <italic>Paralichthys</italic> was not detected in
any other samples in the mesocosm or Pacific. Because <italic>P. adspersus</italic> does not have a
reference sequence available in GenBank (release 238.0) for the region
targeted by the MiFish primers, no species-level detections were possible,
and thus we assessed the detection of this species by eDNA through
annotations to the genus <italic>Paralichthys</italic>. The strong signal of <italic>Paralichthys</italic> in the 12S rRNA results is
particularly notable because the introduction of fish eggs was not detected
via net sampling (Bach et al.,
2020). The fish eggs apparently did not develop and decomposed or sank out
of the mesocosm fairly quickly. Based on their size, the estimated sinking
rate for <italic>P. adspersus</italic> eggs, which average a diameter of 0.66–0.80 mm (Silva
and Oliva, 2010), is about 5 mm s<inline-formula><mml:math id="M180" display="inline"><mml:msup><mml:mi/><mml:mrow><mml:mo>-</mml:mo><mml:mn mathvariant="normal">1</mml:mn></mml:mrow></mml:msup></mml:math></inline-formula> (Robertson, 1981).
Additionally, for any eggs that hatched, larval settling rates for two other
species of <italic>Paralichthys</italic> is estimated to be about 10 mm s<inline-formula><mml:math id="M181" display="inline"><mml:msup><mml:mi/><mml:mrow><mml:mo>-</mml:mo><mml:mn mathvariant="normal">1</mml:mn></mml:mrow></mml:msup></mml:math></inline-formula>
(Hare et al., 2006). With the
very stable, stratified waters of the mesocosm, the lack of turbulence
likely would have caused any eggs or larvae to quickly settle out of the
water column, and coupled with eDNA decay rates, it is not surprising that
this signal was no longer detected in the eDNA sample taken on day 42.</p>
      <p id="d1e3133">The final and most pronounced influence on the vertebrate composition within
the mesocosm was the impact of seabirds, which occasionally rested on the
mesocosms until day 36 but increased abruptly in abundance thereafter
(Bach et al., 2020). DNA from both
seabirds and their prey was detected in the second half of the experiment.
Inca tern (<italic>Larosterna inca</italic>), the most common bird observed on the mesocosms, was detected
in the last two mesocosm samples (days 42 and 48), while brown pelican
(<italic>Pelecanus occidentalis</italic>) was detected in the mesocosm on day 36 (Fig. 4b). While bony fish are the
intended target of the MiFish primers, these primers are also capable of
detecting other vertebrates due to sequence similarity in the targeted
region of 12S rRNA gene, albeit with weaker amplification
(Miya et al., 2015; Monuki et al., 2021).
As such, while we detected seabirds using our primers, they are likely not
well represented in our data; primers that specifically target birds should
improve assessments of their eDNA (Ushio et al.,
2018). Inca terns are known to feed primarily on <italic>E. ringens</italic>, and the defecation by
these seabirds into the mesocosm is inferred by the increase in <italic>Engraulis</italic> DNA in the
last four samples. Additionally, many reads assigned to the family
Sciaenidae (drums and croakers) were detected in the mesocosm, but because
of the lack of reference sequences for most of the species in this family
that are found in the coastal waters of Peru, it is impossible to determine
the identity of these species. However, members of the family Sciaenidae
have been documented to be important prey species for seabirds in other
regions (Lamb et al., 2017). In addition,
the increase in small bacteria (Fig. 2j) in both the mesocosm and the
Pacific may be a result of the seabirds defecating in and around the
mesocosm.</p>
</sec>
<sec id="Ch1.S4.SS5">
  <label>4.5</label><title>Strengths and limitations of eDNA metabarcoding in mesocosm experiments</title>
      <p id="d1e3156">Through the use of eDNA metabarcoding targeting multiple genetic loci, we
were able to examine community-level changes, detecting 12 244 ASVs assigned
to 85 unique phyla; amongst these ASVs, the taxonomy of 816 ASVs could be
resolved to the genus level. Sampling methods commonly used to assess
communities often inherently size-select (vertical net tows;
Skjoldal et al., 2013), are
hindered by both the labor-intensive nature of morphological assessments
and the inherent variation in expertise amongst taxonomists
(Harvey et al., 2017),
and are limited in the taxonomic resolution they provide (e.g., flow
cytometry). eDNA metabarcoding provides a method that overcomes some of
these limitations: by sampling genetic material in seawater, there is higher
sensitivity for detection, there is no minimum size threshold (as there is in light
microscopy or net tows), and metabarcoding of genetic material provides
objective taxonomic assignments at higher resolution than morphological
identification (Berry et al., 2015),
depending on the variable region sequenced and its efficacy for resolving
different taxonomic groups
(Wear
et al., 2018; Parada et al., 2016).</p>
      <p id="d1e3159">eDNA metabarcoding also comes with a number of challenges and limitations,
particularly the issue of incomplete reference databases. For example,
amongst the 88 COI ASVs that met the criteria for inclusion in the analysis
of PC1 loading scores (Fig. 3e–h), only 17 had a match greater than 95 %
to a reference sequence. Most of the COI ASVs identified as driving
differences between the mesocosm and Pacific samples and visualized in Fig. 3e had percent matches to reference sequences of 80 %–90 % and thus were
either annotated to higher orders of taxonomy or left unassigned; the only
exceptions to this are the ASVs assigned to <italic>Akashiwo sanguinea</italic>, <italic>Emiliania huxleyi</italic>, <italic>Skeletonema</italic>, and Class V prasinophytes.
A similar issue occurred with the 12S rRNA data – because of the lack of
reference sequences for<?pagebreak page1291?> Peruvian fish, most ASVs could only be annotated
to the genus or family level. While reference databases are constantly
improving thanks to large-scale sequencing efforts
(e.g.,
Rimet et al., 2016; Gold et al., 2021), the lack of reference sequences will
continue to hinder metabarcoding efforts, especially for uncharismatic and
cryptic taxa.</p>
</sec>
<sec id="Ch1.S4.SS6">
  <label>4.6</label><title>Summary and conclusion</title>
      <p id="d1e3179">In this study multiple marker eDNA metabarcodes were used to follow the
evolution of diverse communities in an in situ mesocosm and the nearby unenclosed
Pacific Ocean over 50 d. A quick divergence between mesocosm and open
ocean communities was observed at multiple trophic levels. The mesocosm
community evolved quickly into one that is common in stable, stratified
conditions (Smayda and Trainer, 2010;
Margalef, 1978). Spilling et al. (2018) have noted that in the
Baltic, dinoflagellates respond to increases in stratification driven by
either changes in salinity or temperature. The Pacific community retained
the character of communities found under nutrient-replete upwelling
conditions. Upwelling conditions are associated with increased nutrient
availability and turbulence
(Chavez and Messié, 2009),
favoring fast-growing, non-motile phytoplankton such as diatoms
(Margalef, 1978). Conversely, weak upwelling and increased
stratification result in reduced mixing and removal of nutrients from the
shallow mixed layer (Smayda and Trainer,
2010), favoring motile organisms like dinoflagellates who are able to
migrate to the nutricline at night without the hindrance of turbulence
(Smayda, 2010; Margalef, 1978). The
bacterial communities reflected the changes in phytoplankton composition and
likely the influence of seabirds. Many of the abundant bacterial taxa in the
mesocosm are reported to increase in response to blooms of dinoflagellates,
while typical open-ocean cyanobacteria (Synechococcaceae) and heterotrophic
bacteria (e.g., SAR86) were more abundant in the Pacific. The increase in
resting seabirds towards the end of the experiment led to unusual bacterial
groups that have been reported to be present in the guts of animals (namely
the Saccharibacteria). Primary and secondary consumers in upwelling
ecosystems, such as zooplankton and fish, have slower responses to
physicochemical conditions, so their responses were incompletely resolved in
the 50 d experiment.</p>
      <p id="d1e3182">The method of eDNA metabarcoding is rapidly evolving, facing a series of
challenges and opportunities. For example, incomplete reference database
issues hindered the confidence of our taxonomic assignments. This was
particularly notable off the coast of Peru, where few species have been
well-characterized genetically. Nonetheless, the multiple-marker eDNA
metabarcoding results presented here show how single samples can yield
results that are comparable and complementary to a multitude of traditional
and other emerging methods to survey marine biodiversity across the tree of
life. The application of multiple genetic markers provided insight into how
multiple trophic levels interact under changing physical and biological
(seabirds) conditions, revealing coupled changes in bacterial (16S),
phytoplankton (18S), zooplankton (COI), and vertebrate (12S) communities.
They also revealed evidence of potential predator–prey and parasite–host
relationships, whose complexity could be explored further in interaction
networks.</p>
      <p id="d1e3185">The effects of perturbations, either purposeful (additions of OMZ water,
brine solution, and fish eggs) or unintended (seabird droppings), on marine
communities were clearly resolved with our methods. The perturbations
provided new insights into ecosystem processes that are difficult to study
otherwise. Mesocosm experiments are challenging because of the difficulties
of reproducing physical conditions in contained systems. However,
fundamental ecosystem processes in the ocean (i.e., stratification) can be
well studied with mesocosms as described here. The selection of
dinoflagellates under the combined effect of the salinity-driven stratified
conditions in the mesocosm and the warm conditions brought about by the
coastal El Niño (which affected both the mesocosm and Pacific) may be an
indication of how EBUS could respond to the global environmental changes (in
both salinity and temperature) forecast for the future (Pachauri et al.,
2014). In support of this, evidence from the fossil record indicates that
during the Paleocene thermal maximum, when temperatures where warmer than
present, there was a global response of surface-dwelling coastal
dinoflagellate communities
(Crouch et al., 2001).
Mesocosm experiments, like the one studied here, provide a valuable
complement to traditional observational studies of upwelling systems.
Insights from the genetic methods applied here will guide us towards a more
mechanistic understanding of the processes that are shaping EBUS communities
in a changing ocean.</p>
</sec>
</sec>

      
      </body>
    <back><notes notes-type="codedataavailability"><title>Code and data availability</title>

      <p id="d1e3194">All code and data required to reproduce the analytical results, figures, and
tables for this study are available on GitHub at <uri>https://github.com/MBARI-BOG/KOSMOS_eDNA_paper</uri> (last access: 21 February 2023, <ext-link xlink:href="https://doi.org/10.5281/Zenodo.7255826" ext-link-type="DOI">10.5281/Zenodo.7255826</ext-link>,  Min and Pitz, 2022).</p>
  </notes><app-group>
        <supplementary-material position="anchor"><p id="d1e3203">The supplement related to this article is available online at: <inline-supplementary-material xlink:href="https://doi.org/10.5194/bg-20-1277-2023-supplement" xlink:title="pdf">https://doi.org/10.5194/bg-20-1277-2023-supplement</inline-supplementary-material>.</p></supplementary-material>
        </app-group><notes notes-type="authorcontribution"><title>Author contributions</title>

      <p id="d1e3212">MAM, DMN, SS, NKT, KJP, AZW, and FPC wrote the paper. MAM and DMN conducted the
data analysis. GMC led the collection and preservation of eDNA samples with
assistance from DMN and CP. CP led the collection and preservation of flow
cytometry samples with assistance from GMC and DMN. BG analyzed the flow
cytometry data. EvdE analyzed the nutrients. UR and AL designed the overall
mesocosm experiment. FPC and AZW designed the sampling/analyses of samples
described in the paper and secured funding to carry out the work.</p>
  </notes><notes notes-type="competinginterests"><title>Competing interests</title>

      <?pagebreak page1292?><p id="d1e3218">The contact author has declared that none of the authors has any competing interests.</p>
  </notes><notes notes-type="disclaimer"><title>Disclaimer</title>

      <p id="d1e3224">Publisher's note: Copernicus Publications remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.</p>
  </notes><notes notes-type="sistatement"><title>Special issue statement</title>

      <p id="d1e3230">This article is part of the special issue “Ecological and biogeochemical functioning of the coastal upwelling system off Peru: an in situ mesocosm study”. It is not associated with a conference.</p>
  </notes><ack><title>Acknowledgements</title><p id="d1e3236">We thank the members of the GEOMAR team and Carlos Robles from IMARPE for
providing logistical, physical, and moral support during the experiment.</p></ack><notes notes-type="financialsupport"><title>Financial support</title>

      <p id="d1e3241">This research has been supported by the Gordon and Betty Moore Foundation (grant no. GBMF 3788); the National Aeronautics and Space Administration, Earth Sciences Division (grant no. NNX14AP62A); and the National Science Foundation, Directorate for Biological Sciences (grant no. NSF DEB-1639033).</p>
  </notes><notes notes-type="reviewstatement"><title>Review statement</title>

      <p id="d1e3247">This paper was edited by Hans-Peter Grossart and reviewed by two anonymous referees.</p>
  </notes><ref-list>
    <title>References</title>

      <ref id="bib1.bib1"><label>1</label><?label 1?><mixed-citation>Agarwala, R., Barrett, T., Beck, J., Benson, D. A., Bollin, C., Bolton, E.,
Bourexis, D., Brister, J. R., Bryant, S. H., Canese, K., Cavanaugh, M.,
Charowhas, C., Clark, K., Dondoshansky, I., Feolo, M., Fitzpatrick, L.,
Funk, K., Geer, L. Y., Gorelenkov, V., Graeff, A., Hlavina, W., Holmes, B.,
Johnson, M., Kattman, B., Khotomlianski, V., Kimchi, A., Kimelman, M.,
Kimura, M., Kitts, P., Klimke, W., Kotliarov, A., Krasnov, S., Kuznetsov,
A., Landrum, M. J., Landsman, D., Lathrop, S., Lee, J. M., Leubsdorf, C.,
Lu, Z., Madden, T. L., Marchler-Bauer, A., Malheiro, A., Meric, P.,
Karsch-Mizrachi, I., Mnev, A., Murphy, T., Orris, R., Ostell, J.,
O'Sullivan, C., Palanigobu, V., Panchenko, A. R., Phan, L., Pierov, B.,
Pruitt, K. D., Rodarmer, K., Sayers, E. W., Schneider, V., Schoch, C. L.,
Schuler, G. D., Sherry, S. T., Siyan, K., Soboleva, A., Soussov, V.,
Starchenko, G., Tatusova, T. A., Thibaud-Nissen, F., Todorov, K., Trawick,
B. W., Vakatov, D., Ward, M., Yaschenko, E., Zasypkin, A., and Zbicz, K.:
Database resources of the National Center for Biotechnology Information,
Nucl. Acids Res., 46, D8–D13, <ext-link xlink:href="https://doi.org/10.1093/nar/gkx1095" ext-link-type="DOI">10.1093/nar/gkx1095</ext-link>, 2018.</mixed-citation></ref>
      <ref id="bib1.bib2"><label>2</label><?label 1?><mixed-citation>Amaral-Zettler, L. A., McCliment, E. A., Ducklow, H. W., and Huse, S. M.: A
method for studying protistan diversity using massively parallel sequencing
of V9 hypervariable regions of small-subunit ribosomal RNA Genes, PLoS One,
4, 1–9, <ext-link xlink:href="https://doi.org/10.1371/journal.pone.0006372" ext-link-type="DOI">10.1371/journal.pone.0006372</ext-link>, 2009.</mixed-citation></ref>
      <ref id="bib1.bib3"><label>3</label><?label 1?><mixed-citation>Amaral-Zettler, L. A., Bauer, M., Berg-Lyons, D., Betley, J., Caporaso, J.
G., Ducklow, H. W., Fierer, N., Fraser, L., Gilbert, J. A., Gormley, N.,
Huntley, J., Huse, S. M., Jansson, J. K., Jarman, S. N., Knight, R., Lau, C.
L., and Walters, W. A.: EMP 18S Illumina Amplicon Protocol, protocols.io,
<ext-link xlink:href="https://doi.org/10.17504/protocols.io.nuvdew6" ext-link-type="DOI">10.17504/protocols.io.nuvdew6</ext-link>, 2018.</mixed-citation></ref>
      <ref id="bib1.bib4"><label>4</label><?label 1?><mixed-citation>Ayón, P., Swartzman, G., Bertrand, A., Gutiérrez, M., and Bertrand,
S.: Zooplankton and forage fish species off Peru: Large-scale bottom-up
forcing and local-scale depletion, Prog. Oceanogr., 79, 208–214,
<ext-link xlink:href="https://doi.org/10.1016/j.pocean.2008.10.023" ext-link-type="DOI">10.1016/j.pocean.2008.10.023</ext-link>, 2008.</mixed-citation></ref>
      <ref id="bib1.bib5"><label>5</label><?label 1?><mixed-citation>Bach, L. T., Paul, A. J., Boxhammer, T., von der Esch, E., Graco, M.,
Schulz, K. G., Achterberg, E., Aguayo, P., Arístegui, J., Ayón, P.,
Baños, I., Bernales, A., Boegeholz, A. S., Chavez, F., Chavez, G., Chen,
S. M., Doering, K., Filella, A., Fischer, M., Grasse, P., Haunost, M.,
Hennke, J., Hernández-Hernández, N., Hopwood, M., Igarza, M.,
Kalter, V., Kittu, L., Kohnert, P., Ledesma, J., Lieberum, C., Lischka, S.,
Löscher, C., Ludwig, A., Mendoza, U., Meyer, J., Meyer, J., Minutolo,
F., Cortes, J. O., Piiparinen, J., Sforna, C., Spilling, K., Sanchez, S.,
Spisla, C., Sswat, M., Moreira, M. Z., and Riebesell, U.: Factors
controlling plankton community production, export flux, and particulate
matter stoichiometry in the coastal upwelling system off Peru,
Biogeosciences, 17, 4831–4852, <ext-link xlink:href="https://doi.org/10.5194/bg-17-4831-2020" ext-link-type="DOI">10.5194/bg-17-4831-2020</ext-link>,
2020.</mixed-citation></ref>
      <ref id="bib1.bib6"><label>6</label><?label 1?><mixed-citation>Bachy, C., Wittmers, F., Muschiol, J., Hamilton, M., Henrissat, B., and
Worden, A. Z.: The Land-Sea Connection: Insights Into the Plant Lineage from
a Green Algal Perspective, Annu. Rev. Plant Biol., 73, 585–616,
<ext-link xlink:href="https://doi.org/10.1146/annurev-arplant-071921-100530" ext-link-type="DOI">10.1146/annurev-arplant-071921-100530</ext-link>, 2022.</mixed-citation></ref>
      <ref id="bib1.bib7"><label>7</label><?label 1?><mixed-citation>Baker, P., Minzlaff, U., Schoenle, A., Schwabe, E., Hohlfeld, M., Jeuck, A.,
Brenke, N., Prausse, D., Rothenbeck, M., Brix, S., Frutos, I., Jörger,
K. M., Neusser, T. P., Koppelmann, R., Devey, C., Brandt, A., and Arndt, H.:
Potential contribution of surface-dwelling Sargassum algae to deep-sea
ecosystems in the southern North Atlantic, Deep-Sea Res. Pt. II, 148, 21–34, <ext-link xlink:href="https://doi.org/10.1016/j.dsr2.2017.10.002" ext-link-type="DOI">10.1016/j.dsr2.2017.10.002</ext-link>, 2018.</mixed-citation></ref>
      <ref id="bib1.bib8"><label>8</label><?label 1?><mixed-citation>Berry, O., Bulman, C., Bunce, M., Coghlan, M., Murray, D. C., and Ward, R.
D.: Comparison of morphological and DNA metabarcoding analyses of diets in
exploited marine fishes, Mar. Ecol. Prog. Ser., 540, 167–181,
<ext-link xlink:href="https://doi.org/10.3354/meps11524" ext-link-type="DOI">10.3354/meps11524</ext-link>, 2015.</mixed-citation></ref>
      <ref id="bib1.bib9"><label>9</label><?label 1?><mixed-citation>Boenigk, J. and Arndt, H.: Particle handling during interception feeding by
four species of heterotrophic nanoflagellates, J. Eukaryot. Microbiol., 47,
350–358, <ext-link xlink:href="https://doi.org/10.1111/j.1550-7408.2000.tb00060.x" ext-link-type="DOI">10.1111/j.1550-7408.2000.tb00060.x</ext-link>, 2000.</mixed-citation></ref>
      <ref id="bib1.bib10"><label>10</label><?label 1?><mixed-citation>Bolyen, E., Rideout, J. R., Dillon, M. R., Bokulich, N. A., Abnet, C. C.,
Al-Ghalith, G. A., Alexander, H., Alm, E. J., Arumugam, M., Asnicar, F.,
Bai, Y., Bisanz, J. E., Bittinger, K., Brejnrod, A., Brislawn, C. J., Brown,
C. T., Callahan, B. J., Caraballo-Rodríguez, A. M., Chase, J., Cope, E.
K., Da Silva, R., Diener, C., Dorrestein, P. C., Douglas, G. M., Durall, D.
M., Duvallet, C., Edwardson, C. F., Ernst, M., Estaki, M., Fouquier, J.,
Gauglitz, J. M., Gibbons, S. M., Gibson, D. L., Gonzalez, A., Gorlick, K.,
Guo, J., Hillmann, B., Holmes, S., Holste, H., Huttenhower, C., Huttley, G.
A., Janssen, S., Jarmusch, A. K., Jiang, L., Kaehler, B. D., Kang, K. Bin,
Keefe, C. R., Keim, P., Kelley, S. T., Knights, D., Koester, I., Kosciolek,
T., Kreps, J., Langille, M. G. I., Lee, J., Ley, R., Liu, Y. X., Loftfield,
E.<?pagebreak page1293?>, Lozupone, C., Maher, M., Marotz, C., Martin, B. D., McDonald, D.,
McIver, L. J., Melnik, A. V., Metcalf, J. L., Morgan, S. C., Morton, J. T.,
Naimey, A. T., Navas-Molina, J. A., Nothias, L. F., Orchanian, S. B.,
Pearson, T., Peoples, S. L., Petras, D., Preuss, M. L., Pruesse, E.,
Rasmussen, L. B., Rivers, A., Robeson, M. S., Rosenthal, P., Segata, N.,
Shaffer, M., Shiffer, A., Sinha, R., Song, S. J., Spear, J. R., Swafford, A.
D., Thompson, L. R., Torres, P. J., Trinh, P., Tripathi, A., Turnbaugh, P.
J., Ul-Hasan, S., van der Hooft, J. J. J., Vargas, F., Vázquez-Baeza,
Y., Vogtmann, E., von Hippel, M., Walters, W.,
Wan, Y.,
Wang, M.,
Warren, J.,
Weber, K. C.,
Williamson, C. H. D.,
Willis, A. D.,
Xu, Z. Z.,
Zaneveld, J. R.,
Zhang, Y.,
Zhu, Q.,
Knight, R.,
and Caporaso, J. G.: Reproducible, interactive,
scalable and extensible microbiome data science using QIIME 2, Nat.
Biotechnol., 37, 852–857, <ext-link xlink:href="https://doi.org/10.1038/s41587-019-0209-9" ext-link-type="DOI">10.1038/s41587-019-0209-9</ext-link>, 2019.</mixed-citation></ref>
      <ref id="bib1.bib11"><label>11</label><?label 1?><mixed-citation>Boussarie, G., Bakker, J., Wangensteen, O. S., Mariani, S., Bonnin, L.,
Juhel, J. B., Kiszka, J. J., Kulbicki, M., Manel, S., Robbins, W. D.,
Vigliola, L., and Mouillot, D.: Environmental DNA illuminates the dark
diversity of sharks, Sci. Adv., 4, 5, <ext-link xlink:href="https://doi.org/10.1126/sciadv.aap9661" ext-link-type="DOI">10.1126/sciadv.aap9661</ext-link>,
2018.</mixed-citation></ref>
      <ref id="bib1.bib12"><label>12</label><?label 1?><mixed-citation>Buchan, A., LeCleir, G. R., Gulvik, C. A., and González, J. M.: Master
recyclers: features and functions of bacteria associated with phytoplankton
blooms, Nat. Rev. Microbiol., 12, 686–698, <ext-link xlink:href="https://doi.org/10.1038/nrmicro3326" ext-link-type="DOI">10.1038/nrmicro3326</ext-link>,   2014.</mixed-citation></ref>
      <ref id="bib1.bib13"><label>13</label><?label 1?><mixed-citation>Callahan, B. J., McMurdie, P. J., Rosen, M. J., Han, A. W., Johnson, A. J.
A., and Holmes, S. P.: DADA2: High-resolution sample inference from Illumina
amplicon data, Nat. Methods, 13, 581–583,
<ext-link xlink:href="https://doi.org/10.1038/nmeth.3869" ext-link-type="DOI">10.1038/nmeth.3869</ext-link>, 2016.</mixed-citation></ref>
      <ref id="bib1.bib14"><label>14</label><?label 1?><mixed-citation>Camacho, C., Coulouris, G., Avagyan, V., Ma, N., Papadopoulos, J., Bealer,
K., and Madden, T. L.: BLAST<inline-formula><mml:math id="M182" display="inline"><mml:mo>+</mml:mo></mml:math></inline-formula>: Architecture and applications, BMC
Bioinformatics, 10, 1–9, <ext-link xlink:href="https://doi.org/10.1186/1471-2105-10-421" ext-link-type="DOI">10.1186/1471-2105-10-421</ext-link>, 2009.</mixed-citation></ref>
      <ref id="bib1.bib15"><label>15</label><?label 1?><mixed-citation>Carr, M. E.: Estimation of potential productivity in Eastern Boundary
Currents using remote sensing, Deep-Sea Res. Pt. II, 49,
59–80, <ext-link xlink:href="https://doi.org/10.1016/S0967-0645(01)00094-7" ext-link-type="DOI">10.1016/S0967-0645(01)00094-7</ext-link>, 2001.</mixed-citation></ref>
      <ref id="bib1.bib16"><label>16</label><?label 1?><mixed-citation>Carr, M. E. and Kearns, E. J.: Production regimes in four Eastern Boundary
Current systems, Deep-Sea Res. Pt. II, 50, 3199–3221,
<ext-link xlink:href="https://doi.org/10.1016/j.dsr2.2003.07.015" ext-link-type="DOI">10.1016/j.dsr2.2003.07.015</ext-link>, 2003.</mixed-citation></ref>
      <ref id="bib1.bib17"><label>17</label><?label 1?><mixed-citation>Chavez, F. P. and Messié, M.: A comparison of Eastern Boundary Upwelling
Ecosystems, Prog. Oceanogr., 83, 80–96,
<ext-link xlink:href="https://doi.org/10.1016/j.pocean.2009.07.032" ext-link-type="DOI">10.1016/j.pocean.2009.07.032</ext-link>, 2009.</mixed-citation></ref>
      <ref id="bib1.bib18"><label>18</label><?label 1?><mixed-citation>
Chavez, F. P., Pennington, J. T., Michisaki, R. P., Blum, M., Chavez, G. M.,
Friederich, J., Jones, B., Herlien, R., Kieft, B., and Hobson, B.: Climate
variability and change: response of a coastal ocean ecosystem, Oceanography,
30, 128–145, 2017.</mixed-citation></ref>
      <ref id="bib1.bib19"><label>19</label><?label 1?><mixed-citation>Choi, C. J., Jimenez, V., Needham, D. M., Poirier, C., Bachy, C., Alexander, H., Wilken, S., Chavez, F. P., Sudek, S., Giovannoni, S. J., and Worden, A. Z.: Seasonal and geographical transitions in eukaryotic phytoplankton
community structure in the Atlantic and Pacific Oceans, Front. Microbiol., 11,  542372, <ext-link xlink:href="https://doi.org/10.3389/fmicb.2020.542372" ext-link-type="DOI">10.3389/fmicb.2020.542372</ext-link>, 2020.</mixed-citation></ref>
      <ref id="bib1.bib20"><label>20</label><?label 1?><mixed-citation>Closek, C., Djurhuus, A., Pitz, K., Kelly, R., Michisaki, R., Walz, K., Starks, H., Chavez, F., Boehm, A., and Breitbart, M.: Environmental DNA (eDNA) 18S metabarcoding Illumina MiSeq NGS PCR Protocol, protocols.io,
<ext-link xlink:href="https://doi.org/10.17504/protocols.io.n2vdge6" ext-link-type="DOI">10.17504/protocols.io.n2vdge6</ext-link>, 2018a.</mixed-citation></ref>
      <ref id="bib1.bib21"><label>21</label><?label 1?><mixed-citation>Closek, C., Djurhuus, A., Pitz, K., Kelly, R., Michisaki, R., Walz, K., Starks, H., Chavez, F., Boehm, A., and Breitbart, M.: Environmental DNA (eDNA) COI metabarcoding Illumina MiSeq NGS PCR Protocol, protocols.io,
<ext-link xlink:href="https://doi.org/10.17504/protocols.io.mwnc7de" ext-link-type="DOI">10.17504/protocols.io.mwnc7de</ext-link>, 2018b.</mixed-citation></ref>
      <ref id="bib1.bib22"><label>22</label><?label 1?><mixed-citation>Coats, D. W.: <italic>Duboscquella cachoni</italic> N. Sp., a Parasitic Dinoflagellate Lethal
to Its Tintinnine Host <italic>Eutintinnus pectinis</italic> 1, J. Protozool., 35, 607–617,
1988.</mixed-citation></ref>
      <ref id="bib1.bib23"><label>23</label><?label 1?><mixed-citation>Crouch, E. M., Heilmann-Clausen, C., Brinkhuis, H., Morgans, H. E. G.,
Rogers, K. M., Egger, H., and Schmitz, B.: Global dinoflagellate event
associated with the late Paleocene thermal maximum, Geology, 29, 315–318,
<ext-link xlink:href="https://doi.org/10.1130/0091-7613(2001)029&lt;0315:GDEAWT&gt;2.0.CO;2" ext-link-type="DOI">10.1130/0091-7613(2001)029&lt;0315:GDEAWT&gt;2.0.CO;2</ext-link>, 2001.</mixed-citation></ref>
      <ref id="bib1.bib24"><label>24</label><?label 1?><mixed-citation>Daims, H., Brühl, A., Amann, R., Schleifer, K. H., and Wagner, M.: The
domain-specific probe EUB338 is insufficient for the detection of all
bacteria: Development and evaluation of a more comprehensive probe set,
Syst. Appl. Microbiol., 22, 434–444,
<ext-link xlink:href="https://doi.org/10.1016/S0723-2020(99)80053-8" ext-link-type="DOI">10.1016/S0723-2020(99)80053-8</ext-link>, 1999.</mixed-citation></ref>
      <ref id="bib1.bib25"><label>25</label><?label 1?><mixed-citation>Decelle, J., Romac, S., Stern, R. F., Bendif, E. M., Zingone, A., Audic, S.,
Guiry, M. D., Guillou, L., Tessier, D., Le Gall, F., Gourvil, P., Dos
Santos, A. L., Probert, I., Vaulot, D., de Vargas, C., and Christen, R.:
PhytoREF: A reference database of the plastidial 16S rRNA gene of
photosynthetic eukaryotes with curated taxonomy, Mol. Ecol. Resour., 15,
1435–1445, <ext-link xlink:href="https://doi.org/10.1111/1755-0998.12401" ext-link-type="DOI">10.1111/1755-0998.12401</ext-link>, 2015.</mixed-citation></ref>
      <ref id="bib1.bib26"><label>26</label><?label 1?><mixed-citation>De La Iglesia, R., Echenique-Subiabre, I., Rodríguez-Marconi, S.,
Espinoza, J. P., Von Dassow, P., Ulloa, O., and Trefault, N.: Distinct
oxygen environments shape picoeukaryote assemblages thriving oxygen minimum
zone waters off central Chile, J. Plankton Res., 42, 514–529,
<ext-link xlink:href="https://doi.org/10.1093/plankt/fbaa036" ext-link-type="DOI">10.1093/plankt/fbaa036</ext-link>, 2020.</mixed-citation></ref>
      <ref id="bib1.bib27"><label>27</label><?label 1?><mixed-citation>Didion, J. P., Martin, M., and Collins, F. S.: Atropos: Specific, sensitive,
and speedy trimming of sequencing reads, PeerJ, 2017, 1–19,
<ext-link xlink:href="https://doi.org/10.7717/peerj.3720" ext-link-type="DOI">10.7717/peerj.3720</ext-link>, 2017.</mixed-citation></ref>
      <ref id="bib1.bib28"><label>28</label><?label 1?><mixed-citation>Djurhuus, A., Pitz, K., Sawaya, N. A., Rojas-Márquez, J., Michaud, B.,
Montes, E., Muller-Karger, F., and Breitbart, M.: Evaluation of marine
zooplankton community structure through environmental DNA metabarcoding,
Limnol. Oceanogr. Method., 16, 209–221, <ext-link xlink:href="https://doi.org/10.1002/lom3.10237" ext-link-type="DOI">10.1002/lom3.10237</ext-link>,
2018.</mixed-citation></ref>
      <ref id="bib1.bib29"><label>29</label><?label 1?><mixed-citation>Du, X., Peterson, W., McCulloch, A., and Liu, G.: An unusual bloom of the
dinoflagellate Akashiwo sanguinea off the central Oregon, USA, coast in
autumn 2009, Harmful Algae, 10, 784–793,
<ext-link xlink:href="https://doi.org/10.1016/j.hal.2011.06.011" ext-link-type="DOI">10.1016/j.hal.2011.06.011</ext-link>, 2011.</mixed-citation></ref>
      <ref id="bib1.bib30"><label>30</label><?label 1?><mixed-citation>
Duffy, D. C.: The foraging ecology of Peruvian seabirds, Auk, 100, 800–810,
1983.</mixed-citation></ref>
      <ref id="bib1.bib31"><label>31</label><?label 1?><mixed-citation>
Dugdale, R. C., Goering, J. J., Barber, R. T., Smith, R. L., and Packard, T.
T.: Denitrification and hydrogen sulfide in the Peru upwelling region during
1976, Deep-Sea Res., 24, 601–608, 1977.</mixed-citation></ref>
      <ref id="bib1.bib32"><label>32</label><?label 1?><mixed-citation>Dupont, C. L., Rusch, D. B., Yooseph, S., Lombardo, M. J., Alexander
Richter, R., Valas, R., Novotny, M., Yee-Greenbaum, J., Selengut, J. D.,
Haft, D. H., Halpern, A. L., Lasken, R. S., Nealson, K., Friedman, R., and
Craig Venter, J.: Genomic insights to SAR86, an abundant and uncultivated
marine bacterial lineage, ISME J., 6, 1186–1199,
<ext-link xlink:href="https://doi.org/10.1038/ismej.2011.189" ext-link-type="DOI">10.1038/ismej.2011.189</ext-link>, 2012.</mixed-citation></ref>
      <ref id="bib1.bib33"><label>33</label><?label 1?><mixed-citation>Echevin, V., Puillat, I., Grados, C., and Dewitte, B.: Seasonal and
mesoscale variability in the Peru Upwelling System from in situ data during
the years 2000 to 2004, Gayana (Concepción), 68, 167–173,
<ext-link xlink:href="https://doi.org/10.4067/s0717-65382004000200031" ext-link-type="DOI">10.4067/s0717-65382004000200031</ext-link>, 2004.</mixed-citation></ref>
      <?pagebreak page1294?><ref id="bib1.bib34"><label>34</label><?label 1?><mixed-citation>
Edvarsen, B. and Paasche, E.: Bloom dynamics and physiology of Prymnesium
and Chrysochromulina, Physiol. Ecol. Harmful Algal Bloom., 41, 193–208,
1998.</mixed-citation></ref>
      <ref id="bib1.bib35"><label>35</label><?label 1?><mixed-citation>Espinoza, P. and Bertrand, A.: Revisiting Peruvian anchovy (Engraulis
ringens) trophodynamics provides a new vision of the Humboldt Current
system, Prog. Oceanogr., 79, 215–227,
<ext-link xlink:href="https://doi.org/10.1016/j.pocean.2008.10.022" ext-link-type="DOI">10.1016/j.pocean.2008.10.022</ext-link>, 2008.</mixed-citation></ref>
      <ref id="bib1.bib36"><label>36</label><?label 1?><mixed-citation>Evans, N. T., Olds, B. P., Renshaw, M. A., Turner, C. R., Li, Y., Jerde, C.
L., Mahon, A. R., Pfrender, M. E., Lamberti, G. A., and Lodge, D. M.:
Quantification of mesocosm fish and amphibian species diversity via
environmental DNA metabarcoding, Mol. Ecol. Resour., 16, 29–41,
<ext-link xlink:href="https://doi.org/10.1111/1755-0998.12433" ext-link-type="DOI">10.1111/1755-0998.12433</ext-link>, 2016.</mixed-citation></ref>
      <ref id="bib1.bib37"><label>37</label><?label 1?><mixed-citation>Ferrari, B. C., Binnerup, S. J., and Gillings, M.: Microcolony cultivation
on a soil substrate membrane system selects for previously uncultured soil
bacteria, Appl. Environ. Microbiol., 71, 8714–8720,
<ext-link xlink:href="https://doi.org/10.1128/AEM.71.12.8714-8720.2005" ext-link-type="DOI">10.1128/AEM.71.12.8714-8720.2005</ext-link>, 2005.</mixed-citation></ref>
      <ref id="bib1.bib38"><label>38</label><?label 1?><mixed-citation>
Folmer, O., Hoeh, W. R., Black, M. B., and Vrijenhoek, R. C.: Conserved
primers for PCR amplification of mitochondrial DNA from different
invertebrate phyla, Mol. Mar. Biol. Biotechnol., 3, 294–299, 1994.</mixed-citation></ref>
      <ref id="bib1.bib39"><label>39</label><?label 1?><mixed-citation>Garreaud, R. D.: A plausible atmospheric trigger for the 2017 coastal El
Niño, Int. J. Climatol., 38, e1296–e1302,
<ext-link xlink:href="https://doi.org/10.1002/joc.5426" ext-link-type="DOI">10.1002/joc.5426</ext-link>, 2018.</mixed-citation></ref>
      <ref id="bib1.bib40"><label>40</label><?label 1?><mixed-citation>Giovannoni, S. J., Britschgi, T. B., Moyer, C. L., and Field, K. G.: Genetic
diversity in Sargasso Sea bacterioplankton, Nature, 345, 60–63,
<ext-link xlink:href="https://doi.org/10.1038/345060a0" ext-link-type="DOI">10.1038/345060a0</ext-link>, 1990.</mixed-citation></ref>
      <ref id="bib1.bib41"><label>41</label><?label 1?><mixed-citation>Gold, Z., Curd, E., Goodwin, K., Choi, E., Frable, B., Thompson, A., Burton,
R., Kacev, D., and Barber, P.: Improving metabarcoding taxonomic assignment: A case study of fishes in a large marine ecosystem, Mol. Ecol. Resour., 21, 2546–2564,
<ext-link xlink:href="https://doi.org/10.22541/au.161407483.33882798/v1" ext-link-type="DOI">10.22541/au.161407483.33882798/v1</ext-link>, 2021.</mixed-citation></ref>
      <ref id="bib1.bib42"><label>42</label><?label 1?><mixed-citation>Gómez, F.: On the consortium of the tintinnid Eutintinnus and the diatom
Chaetoceros in the Pacific Ocean, Mar. Biol., 151, 1899–1906,
<ext-link xlink:href="https://doi.org/10.1007/s00227-007-0625-0" ext-link-type="DOI">10.1007/s00227-007-0625-0</ext-link>, 2007.</mixed-citation></ref>
      <ref id="bib1.bib43"><label>43</label><?label 1?><mixed-citation>
Gómez, F.: Symbiotic interactions between ciliates (Ciliophora) and
diatoms (Bacillariophyceae), Rev. Biol. Trop., 68,  2020.</mixed-citation></ref>
      <ref id="bib1.bib44"><label>44</label><?label 1?><mixed-citation>Graco, M. I., Purca, S., Dewitte, B., Castro, C. G., Morón, O., Ledesma,
J., Flores, G., and Gutiérrez, D.: The OMZ and nutrient features as a
signature of interannual and low-frequency variability in the Peruvian
upwelling system, Biogeosciences, 14, 4601–4617,
<ext-link xlink:href="https://doi.org/10.5194/bg-14-4601-2017" ext-link-type="DOI">10.5194/bg-14-4601-2017</ext-link>, 2017.</mixed-citation></ref>
      <ref id="bib1.bib45"><label>45</label><?label 1?><mixed-citation>Gruber, N.: Warming up, turning sour, losing breath: Ocean biogeochemistry
under global change, Philos. T. R. Soc. A, 369,
1980–1996, <ext-link xlink:href="https://doi.org/10.1098/rsta.2011.0003" ext-link-type="DOI">10.1098/rsta.2011.0003</ext-link>, 2011.</mixed-citation></ref>
      <ref id="bib1.bib46"><label>46</label><?label 1?><mixed-citation>Guillou, L., Viprey, M., Chambouvet, A., Welsh, R. M., Kirkham, A. R.,
Massana, R., Scanlan, D. J., and Worden, A. Z.: Widespread occurrence and
genetic diversity of marine parasitoids belonging to Syndiniales
(Alveolata), Environ. Microbiol., 10, 3349–3365,
<ext-link xlink:href="https://doi.org/10.1111/j.1462-2920.2008.01731.x" ext-link-type="DOI">10.1111/j.1462-2920.2008.01731.x</ext-link>, 2008.</mixed-citation></ref>
      <ref id="bib1.bib47"><label>47</label><?label 1?><mixed-citation>Hare, J. A., Walsh, H. J., and Wuenschel, M. J.: Sinking rates of late-stage
fish larvae: Implications for larval ingress into estuarine nursery
habitats, J. Exp. Mar. Bio. Ecol., 330, 493–504,
<ext-link xlink:href="https://doi.org/10.1016/j.jembe.2005.09.011" ext-link-type="DOI">10.1016/j.jembe.2005.09.011</ext-link>, 2006.</mixed-citation></ref>
      <ref id="bib1.bib48"><label>48</label><?label 1?><mixed-citation>Harvey, J. B. J., Johnson, S. B., Fisher, J. L., Peterson, W. T., and
Vrijenhoek, R. C.: Comparison of morphological and next generation DNA
sequencing methods for assessing zooplankton assemblages, J. Exp. Mar. Biol.
Ecol., 487, 113–126, <ext-link xlink:href="https://doi.org/10.1016/j.jembe.2016.12.002" ext-link-type="DOI">10.1016/j.jembe.2016.12.002</ext-link>, 2017.</mixed-citation></ref>
      <ref id="bib1.bib49"><label>49</label><?label 1?><mixed-citation>Hattenrath-Lehmann, T. K. and Gobler, C. J.: Identification of unique
microbiomes associated with harmful algal blooms caused by Alexandrium
fundyense and Dinophysis acuminata, Harmful Algae, 68, 17–30,
<ext-link xlink:href="https://doi.org/10.1016/j.hal.2017.07.003" ext-link-type="DOI">10.1016/j.hal.2017.07.003</ext-link>, 2017.</mixed-citation></ref>
      <ref id="bib1.bib50"><label>50</label><?label 1?><mixed-citation>He, X., McLean, J. S., Edlund, A., Yooseph, S., Hall, A. P., Liu, S. Y.,
Dorrestein, P. C., Esquenazi, E., Hunter, R. C., Cheng, G., Nelson, K. E.,
Lux, R., and Shi, W.: Cultivation of a human-associated TM7 phylotype
reveals a reduced genome and epibiotic parasitic lifestyle, P. Natl.
Acad. Sci. USA, 112, 244–249, <ext-link xlink:href="https://doi.org/10.1073/pnas.1419038112" ext-link-type="DOI">10.1073/pnas.1419038112</ext-link>,
2015.</mixed-citation></ref>
      <ref id="bib1.bib51"><label>51</label><?label 1?><mixed-citation>Herring, S. C., Christidis, N., Hoell, A., Hoerling, M. P., and Stott, P.
A.: Explaining Extreme Events of 2017 from a Climate Perspective, Bull. Am.
Meteorol. Soc., 100, S1–S117,
<ext-link xlink:href="https://doi.org/10.1175/bams-explainingextremeevents2017.1" ext-link-type="DOI">10.1175/bams-explainingextremeevents2017.1</ext-link>, 2019.</mixed-citation></ref>
      <ref id="bib1.bib52"><label>52</label><?label 1?><mixed-citation>Hird, S. M., Sánchez, C., Carstens, B. C., and Brumfield, R. T.:
Comparative gut microbiota of 59 neotropical bird species, Front.
Microbiol., 6, 1403, <ext-link xlink:href="https://doi.org/10.3389/fmicb.2015.01403" ext-link-type="DOI">10.3389/fmicb.2015.01403</ext-link>, 2015.</mixed-citation></ref>
      <ref id="bib1.bib53"><label>53</label><?label 1?><mixed-citation>Hitchcock, J. N., Mitrovic, S. M., Hadwen, W. L., Roelke, D. L., Growns, I.
O., and Rohlfs, A. M.: Terrestrial dissolved organic carbon subsidizes
estuarine zooplankton: An in situ mesocosm study, Limnol. Oceanogr., 61,
254–267, <ext-link xlink:href="https://doi.org/10.1002/lno.10207" ext-link-type="DOI">10.1002/lno.10207</ext-link>, 2016.</mixed-citation></ref>
      <ref id="bib1.bib54"><label>54</label><?label 1?><mixed-citation>Hugenholtz, P., Tyson, G. W., Webb, R. I., Wagner, A. M., and Blackall, L.
L.: Investigation of candidate division TM7, a recently recognized major
lineage of the domain Bacteria, with no known pure-culture representatives,
Appl. Environ. Microbiol., 67, 411–419,
<ext-link xlink:href="https://doi.org/10.1128/AEM.67.1.411-419.2001" ext-link-type="DOI">10.1128/AEM.67.1.411-419.2001</ext-link>, 2001.</mixed-citation></ref>
      <ref id="bib1.bib55"><label>55</label><?label 1?><mixed-citation>Huson, D. H., Beier, S., Flade, I., Górska, A., El-Hadidi, M., Mitra,
S., Ruscheweyh, H. J., and Tappu, R.: MEGAN Community Edition – Interactive
Exploration and Analysis of Large-Scale Microbiome Sequencing Data, PLoS
Comput. Biol., 12, 1–12, <ext-link xlink:href="https://doi.org/10.1371/journal.pcbi.1004957" ext-link-type="DOI">10.1371/journal.pcbi.1004957</ext-link>,
2016.</mixed-citation></ref>
      <ref id="bib1.bib56"><label>56</label><?label 1?><mixed-citation>Huyer, A., Knoll, M., Paluszkiewicz, T., and Smith, R. L.: The Peru
Undercurrent: a study in variability, Deep-Sea Res. Pt. A, 38, S247–S271, <ext-link xlink:href="https://doi.org/10.1016/s0198-0149(12)80012-4" ext-link-type="DOI">10.1016/s0198-0149(12)80012-4</ext-link>, 1991.</mixed-citation></ref>
      <ref id="bib1.bib57"><label>57</label><?label 1?><mixed-citation>Ianora, A.: Copepod life history traits in subtemperate regions, J. Mar.
Syst., 15, 337–349, <ext-link xlink:href="https://doi.org/10.1016/S0924-7963(97)00085-7" ext-link-type="DOI">10.1016/S0924-7963(97)00085-7</ext-link>, 1998.</mixed-citation></ref>
      <ref id="bib1.bib58"><label>58</label><?label 1?><mixed-citation>
Pachauri, R. K., Allen, M. R., Barros, V. R., Broome, J., Cramer, W., Christ, R., Church, J. A., Clarke, L., Dahe, Q., Dasgupta, P., and Dubash, N. K.: Climate change 2014: synthesis report. Contribution of Working Groups I, II and III to the fifth assessment report of the Intergovernmental Panel on Climate Change, p. 151, IPCC, 2014.</mixed-citation></ref>
      <ref id="bib1.bib59"><label>59</label><?label 1?><mixed-citation>Jaffe, A. L., Thomas, A. D., He, C., Keren, R., Valentin-Alvarado, L. E.,
Munk, P., Bouma-Gregson, K., Farag, I. F., Amano, Y., Sachdeva, R., West, P.
T., and Banfield, J. F.: Patterns of gene content and co-occurrence constrain the evolutionary path toward animal association in Candidate Phyla Radiation Bacteria, MBio, 12, e00521-21, <ext-link xlink:href="https://doi.org/10.1128/mBio.00521-21" ext-link-type="DOI">10.1128/mBio.00521-21</ext-link>, 2021.</mixed-citation></ref>
      <?pagebreak page1295?><ref id="bib1.bib60"><label>60</label><?label 1?><mixed-citation>
Kahru, M., Michell, B. G., Diaz, A., and Miura, M.: MODIS detects a
devastating algal bloom in Paracas Bay, Peru, Eos, Trans. Am. Geophys.
Union, 85, 465–472, 2004.</mixed-citation></ref>
      <ref id="bib1.bib61"><label>61</label><?label 1?><mixed-citation>Kelly, R. P., Port, J. A., Yamahara, K. M., and Crowder, L. B.: Using
environmental DNA to census marine fishes in a large mesocosm, PLoS One, 9, e86175,
<ext-link xlink:href="https://doi.org/10.1371/journal.pone.0086175" ext-link-type="DOI">10.1371/journal.pone.0086175</ext-link>, 2014.</mixed-citation></ref>
      <ref id="bib1.bib62"><label>62</label><?label 1?><mixed-citation>Kim, S. and Park, M. G.: Paulinella longichromatophora sp. nov., a New
Marine Photosynthetic Testate Amoeba Containing a Chromatophore, Protist,
167, 1–12, <ext-link xlink:href="https://doi.org/10.1016/j.protis.2015.11.003" ext-link-type="DOI">10.1016/j.protis.2015.11.003</ext-link>, 2016.</mixed-citation></ref>
      <ref id="bib1.bib63"><label>63</label><?label 1?><mixed-citation>Kolody, B. C., McCrow, J. P., Allen, L. Z., Aylward, F. O., Fontanez, K. M.,
Moustafa, A., Moniruzzaman, M., Chavez, F. P., Scholin, C. A., Allen, E. E.,
Worden, A. Z., Delong, E. F., and Allen, A. E.: Diel transcriptional
response of a California Current plankton microbiome to light, low iron, and
enduring viral infection, ISME J., 13, 2817–2833,
<ext-link xlink:href="https://doi.org/10.1038/s41396-019-0472-2" ext-link-type="DOI">10.1038/s41396-019-0472-2</ext-link>, 2019.</mixed-citation></ref>
      <ref id="bib1.bib64"><label>64</label><?label 1?><mixed-citation>Koumandou, V. L., Nisbet, R. E. R., Barbrook, A. C., and Howe, C. J.:
Dinoflagellate chloroplasts – Where have all the genes gone?, Trends Genet.,
20, 261–267, <ext-link xlink:href="https://doi.org/10.1016/j.tig.2004.03.008" ext-link-type="DOI">10.1016/j.tig.2004.03.008</ext-link>, 2004.</mixed-citation></ref>
      <ref id="bib1.bib65"><label>65</label><?label 1?><mixed-citation>Kudela, R. M., Lane, J. Q., and Cochlan, W. P.: The potential role of
anthropogenically derived nitrogen in the growth of harmful algae in
California, USA, Harmful Algae, 8, 103–110,
<ext-link xlink:href="https://doi.org/10.1016/j.hal.2008.08.019" ext-link-type="DOI">10.1016/j.hal.2008.08.019</ext-link>, 2008.</mixed-citation></ref>
      <ref id="bib1.bib66"><label>66</label><?label 1?><mixed-citation>Kudela, R. M., Seeyave, S., and Cochlan, W. P.: The role of nutrients in
regulation and promotion of harmful algal blooms in upwelling systems, Prog.
Oceanogr., 85, 122–135, <ext-link xlink:href="https://doi.org/10.1016/j.pocean.2010.02.008" ext-link-type="DOI">10.1016/j.pocean.2010.02.008</ext-link>, 2010.</mixed-citation></ref>
      <ref id="bib1.bib67"><label>67</label><?label 1?><mixed-citation>Kuehbacher, T., Rehman, A., Lepage, P., Hellmig, S., Fölsch, U. R.,
Schreiber, S., and Ott, S. J.: Intestinal TM7 bacterial phylogenies in
active inflammatory bowel disease, J. Med. Microbiol., 57, 1569–1576,
<ext-link xlink:href="https://doi.org/10.1099/jmm.0.47719-0" ext-link-type="DOI">10.1099/jmm.0.47719-0</ext-link>, 2008.</mixed-citation></ref>
      <ref id="bib1.bib68"><label>68</label><?label 1?><mixed-citation>Lamb, J. S., Satgé, Y. G., and Jodice, P. G. R.: Diet composition and
provisioning rates of nestlings determine reproductive success in a
subtropical seabird, Mar. Ecol. Prog. Ser., 581, 149–164,
<ext-link xlink:href="https://doi.org/10.3354/meps12301" ext-link-type="DOI">10.3354/meps12301</ext-link>, 2017.</mixed-citation></ref>
      <ref id="bib1.bib69"><label>69</label><?label 1?><mixed-citation>Lemos, L. N., Medeiros, J. D., Dini-Andreote, F., Fernandes, G. R., Varani,
A. M., Oliveira, G., and Pylro, V. S.: Genomic signatures and co-occurrence
patterns of the ultra-small Saccharimonadia (phylum CPR/Patescibacteria)
suggest a symbiotic lifestyle, Mol. Ecol., 28, 4259–4271,
<ext-link xlink:href="https://doi.org/10.1111/mec.15208" ext-link-type="DOI">10.1111/mec.15208</ext-link>, 2019.</mixed-citation></ref>
      <ref id="bib1.bib70"><label>70</label><?label 1?><mixed-citation>Leray, M., Yang, J. Y., Meyer, C. P., Mills, S. C., Agudelo, N., Ranwez, V.,
Boehm, J. T., and Machida, R. J.: A new versatile primer set targeting a
short fragment of the mitochondrial COI region for metabarcoding metazoan
diversity: Application for characterizing coral reef fish gut contents,
Front. Zool., 10, 1–14, <ext-link xlink:href="https://doi.org/10.1186/1742-9994-10-34" ext-link-type="DOI">10.1186/1742-9994-10-34</ext-link>, 2013.</mixed-citation></ref>
      <ref id="bib1.bib71"><label>71</label><?label 1?><mixed-citation>Limardo, A. J., Sudek, S., Choi, C. J., Poirier, C., Rii, Y. M., Blum, M.,
Roth, R., Goodenough, U., Church, M. J., and Worden, A. Z.: Quantitative
biogeography of picoprasinophytes establishes ecotype distributions and
significant contributions to marine phytoplankton, Environ. Microbiol., 19,
3219–3234, <ext-link xlink:href="https://doi.org/10.1111/1462-2920.13812" ext-link-type="DOI">10.1111/1462-2920.13812</ext-link>, 2017.</mixed-citation></ref>
      <ref id="bib1.bib72"><label>72</label><?label 1?><mixed-citation>Lin, S., Zhang, H., Hou, Y., Zhuang, Y., and Miranda, L.: High-level
diversity of dinoflagellates in the natural environment, revealed by
assessment of mitochondrial cox1 and cob genes for dinoflagellate DNA
barcoding, Appl. Environ. Microbiol., 75, 1279–1290,
<ext-link xlink:href="https://doi.org/10.1128/AEM.01578-08" ext-link-type="DOI">10.1128/AEM.01578-08</ext-link>, 2009.</mixed-citation></ref>
      <ref id="bib1.bib73"><label>73</label><?label 1?><mixed-citation>Marcy, Y., Ouverney, C., Bik, E. M., Lösekann, T., Ivanova, N., Martin,
H. G., Szeto, E., Platt, D., Hugenholtz, P., Relman, D. A., and Quake, S.
R.: Dissecting biological “dark matter” with single-cell genetic analysis
of rare and uncultivated TM7 microbes from the human mouth, P. Natl.
Acad. Sci. USA, 104, 11889–11894,
<ext-link xlink:href="https://doi.org/10.1073/pnas.0704662104" ext-link-type="DOI">10.1073/pnas.0704662104</ext-link>, 2007.</mixed-citation></ref>
      <ref id="bib1.bib74"><label>74</label><?label 1?><mixed-citation>
Margalef, R.: Life-forms of phytoplankton as survival alternatives in an
unstable environment, Ocean. Acta, 1, 493–509, 1978.</mixed-citation></ref>
      <ref id="bib1.bib75"><label>75</label><?label 1?><mixed-citation>Martin, J. L., Santi, I., Pitta, P., John, U., and Gypens, N.: Towards
quantitative metabarcoding of eukaryotic plankton: an approach to improve
18S rRNA gene copy number bias, Metabarcod. Metagenom., 6, 245–259,
<ext-link xlink:href="https://doi.org/10.3897/mbmg.6.85794" ext-link-type="DOI">10.3897/mbmg.6.85794</ext-link>, 2022.</mixed-citation></ref>
      <ref id="bib1.bib76"><label>76</label><?label 1?><mixed-citation>Martin, M.: Cutadapt removes adapter sequences from high-throughput
sequencing reads, EMBnet J., 17, 10–12,
<ext-link xlink:href="https://doi.org/10.14806/ej.17.1.200" ext-link-type="DOI">10.14806/ej.17.1.200</ext-link>, 2011.</mixed-citation></ref>
      <ref id="bib1.bib77"><label>77</label><?label 1?><mixed-citation>Martino, C., Morton, J. T., Marotz, C. A., Thompson, L. R., Tripathi, A.,
Knight, R., and Zengler, K.: A Novel Sparse Compositional Technique Reveals
Microbial Perturbations, MSystems, 4, e00016-19,
<ext-link xlink:href="https://doi.org/10.1128/msystems.00016-19" ext-link-type="DOI">10.1128/msystems.00016-19</ext-link>, 2019.</mixed-citation></ref>
      <ref id="bib1.bib78"><label>78</label><?label 1?><mixed-citation>Matsuyama, Y., Miyamoto, M., and Kotani, Y.: Grazing impacts of the
heterotrophic dinoflagellate Polykrikos kofoidii on a bloom of Gymnodinium
catenatum, Aquat. Microb. Ecol., 17, 91–98,
<ext-link xlink:href="https://doi.org/10.3354/ame017091" ext-link-type="DOI">10.3354/ame017091</ext-link>, 1999.</mixed-citation></ref>
      <ref id="bib1.bib79"><label>79</label><?label 1?><mixed-citation>Messié, M. and Chavez, F. P.: Seasonal regulation of primary production
in eastern boundary upwelling systems, Prog. Oceanogr., 134, 1–18,
<ext-link xlink:href="https://doi.org/10.1016/j.pocean.2014.10.011" ext-link-type="DOI">10.1016/j.pocean.2014.10.011</ext-link>, 2015.</mixed-citation></ref>
      <ref id="bib1.bib80"><label>80</label><?label 1?><mixed-citation>Min, M. and Pitz, K.: MBARI-BOG/KOSMOS_eDNA_paper: Initial submission to Biogeosciences (v1.0), Zenodo [code and data set],
<ext-link xlink:href="https://doi.org/10.5281/zenodo.7255826" ext-link-type="DOI">10.5281/zenodo.7255826</ext-link>, 2022.</mixed-citation></ref>
      <ref id="bib1.bib81"><label>81</label><?label 1?><mixed-citation>Miya, M., Sato, Y., Fukunaga, T., Sado, T., Poulsen, J.Y., Sato, K., Minamoto, T., Yamamoto, S., Yamanaka, H., Araki, H., and Kondoh, M.: MiFish, a set of universal PCR primers for metabarcoding environmental DNA from fishes: detection of more than 230 subtropical marine species, Roy. Soc. Open Sci., 2,  150088, <ext-link xlink:href="https://doi.org/10.1098/rsos.150088" ext-link-type="DOI">10.1098/rsos.150088</ext-link>, 2015.</mixed-citation></ref>
      <ref id="bib1.bib82"><label>82</label><?label 1?><mixed-citation>Monuki, K., Barber, P. H., and Gold, Z.: eDNA captures depth partitioning in
a kelp forest ecosystem, PLoS One, 16, 1–17,
<ext-link xlink:href="https://doi.org/10.1371/journal.pone.0253104" ext-link-type="DOI">10.1371/journal.pone.0253104</ext-link>, 2021.</mixed-citation></ref>
      <ref id="bib1.bib83"><label>83</label><?label 1?><mixed-citation>Morris, A. W. and Riley, J. P.: The determination of nitrate in sea water,
Anal. Chim. Acta, 29, 272–279,
<ext-link xlink:href="https://doi.org/10.1016/S0003-2670(00)88614-6" ext-link-type="DOI">10.1016/S0003-2670(00)88614-6</ext-link>, 1963.</mixed-citation></ref>
      <ref id="bib1.bib84"><label>84</label><?label 1?><mixed-citation>Morris, R. M., Rappé, M. S., Connon, S. A., Vergin, K. L., Siebold, W.
A., Carlson, C. A., and Giovannoni, S. J.: SAR11 clade dominates ocean
surface bacterioplankton communities, Nature, 420, 806–810,
<ext-link xlink:href="https://doi.org/10.1038/nature01240" ext-link-type="DOI">10.1038/nature01240</ext-link>, 2002.</mixed-citation></ref>
      <ref id="bib1.bib85"><label>85</label><?label 1?><mixed-citation>Mullin, J. B. and Riley, J. P.: The colorimetric determination of silicate
with special reference to sea and natural waters, Anal. Chim. Acta, 12,
162–176, <ext-link xlink:href="https://doi.org/10.1016/S0003-2670(00)87825-3" ext-link-type="DOI">10.1016/S0003-2670(00)87825-3</ext-link>, 1955.</mixed-citation></ref>
      <ref id="bib1.bib86"><label>86</label><?label 1?><mixed-citation>Needham, D. M. and Fuhrman, J. A.: Pronounced daily succession of
phytoplankton, archaea and bacteria following a spring bloom, Nat.
Microbiol., 1, 16005, <ext-link xlink:href="https://doi.org/10.1038/nmicrobiol.2016.5" ext-link-type="DOI">10.1038/nmicrobiol.2016.5</ext-link>, 2016.</mixed-citation></ref>
      <ref id="bib1.bib87"><label>87</label><?label 1?><mixed-citation>Neufeld, J. D., Schäfer, H., Cox, M. J., Boden, R., McDonald, I. R., and
Murrell, J. C.: Stable-isotope probing implicates Methylophaga spp and novel
Gammaproteobacteria in marin<?pagebreak page1296?>e methanol and methylamine metabolism, ISME J.,
1, 480–491, <ext-link xlink:href="https://doi.org/10.1038/ismej.2007.65" ext-link-type="DOI">10.1038/ismej.2007.65</ext-link>, 2007.</mixed-citation></ref>
      <ref id="bib1.bib88"><label>88</label><?label 1?><mixed-citation>O'donnell, J. L., Kelly, R. P., Lowell, N. C., and Port, J. A.: Indexed PCR
primers induce template- Specific bias in Large-Scale DNA sequencing
studies, PLoS One, 11, 1–11, <ext-link xlink:href="https://doi.org/10.1371/journal.pone.0148698" ext-link-type="DOI">10.1371/journal.pone.0148698</ext-link>,
2016.</mixed-citation></ref>
      <ref id="bib1.bib89"><label>89</label><?label 1?><mixed-citation>Ohki, K., Yamada, K., Kamiya, M., and Yoshikawa, S.: Morphological,
phylogenetic and physiological studies of pico-cyanobacteria isolated from
the halocline of a saline Meromictic Lake, Lake Suigetsu, Japan, Microbes
Environ., 27, 171–178, <ext-link xlink:href="https://doi.org/10.1264/jsme2.ME11329" ext-link-type="DOI">10.1264/jsme2.ME11329</ext-link>, 2012.</mixed-citation></ref>
      <ref id="bib1.bib90"><label>90</label><?label 1?><mixed-citation>
Page, F. C.: Marine gymnamoebae, Institute of Terrestrial Ecology, 60 pp.,  1983.</mixed-citation></ref>
      <ref id="bib1.bib91"><label>91</label><?label 1?><mixed-citation>Parada, A. E., Needham, D. M., and Fuhrman, J. A.: Every base matters:
Assessing small subunit rRNA primers for marine microbiomes with mock
communities, time series and global field samples, Environ. Microbiol., 18,
1403–1414, <ext-link xlink:href="https://doi.org/10.1111/1462-2920.13023" ext-link-type="DOI">10.1111/1462-2920.13023</ext-link>, 2016.</mixed-citation></ref>
      <ref id="bib1.bib92"><label>92</label><?label 1?><mixed-citation>Park, M. G. and Kim, M.: Prey specificity and feeding of the thecate
mixotrophic dinoflagellate fragilidium duplocampanaeforme, J. Phycol., 46,
424–432, <ext-link xlink:href="https://doi.org/10.1111/j.1529-8817.2010.00824.x" ext-link-type="DOI">10.1111/j.1529-8817.2010.00824.x</ext-link>, 2010.</mixed-citation></ref>
      <ref id="bib1.bib93"><label>93</label><?label 1?><mixed-citation>Park, S., Jung, Y. T., Park, J. M., and Yoon, J. H.: <italic>Pseudohongiella acticola</italic> sp. nov., a novel gammaproteobacterium isolated from seawater, and
emended description of the genus Pseudohongiella, Antonie van Leeuwenhoek,
Int. J. Gen. Mol. Microbiol., 106, 809–815,
<ext-link xlink:href="https://doi.org/10.1007/s10482-014-0250-0" ext-link-type="DOI">10.1007/s10482-014-0250-0</ext-link>, 2014.</mixed-citation></ref>
      <ref id="bib1.bib94"><label>94</label><?label 1?><mixed-citation>Parks, D. H., Chuvochina, M., Waite, D. W., Rinke, C., Skarshewski, A.,
Chaumeil, P. A., and Hugenholtz, P.: A standardized bacterial taxonomy based
on genome phylogeny substantially revises the tree of life, Nat.
Biotechnol., 36,  996–1004, <ext-link xlink:href="https://doi.org/10.1038/nbt.4229" ext-link-type="DOI">10.1038/nbt.4229</ext-link>, 2018.</mixed-citation></ref>
      <ref id="bib1.bib95"><label>95</label><?label 1?><mixed-citation>
Partensky, F., Blanchot, J., and Vaulot, D.: Differential distribution and
ecology of Prochlorococcus and Synechococcus in oceanic waters: A review,
Bull. Inst. Ocean., 19, 457–475, 1999.</mixed-citation></ref>
      <ref id="bib1.bib96"><label>96</label><?label 1?><mixed-citation>Patterson, D., Nygaard, K., Steinberg, G., and Turley, C.: Heterotrophic
flagellates and other protists associated with oceanic detritus throughout
the water column in the mid north atlantic, J. Mar. Biol. Assoc. United
Kingdom, 73, 67–95, <ext-link xlink:href="https://doi.org/10.1017/S0025315400032653" ext-link-type="DOI">10.1017/S0025315400032653</ext-link>, 1993.</mixed-citation></ref>
      <ref id="bib1.bib97"><label>97</label><?label 1?><mixed-citation>Patti, B., Guisande, C., Vergara, A. R., Riveiro, I., Maneiro, I., Barreiro,
A., Bonanno, A., Buscaino, G., Cuttitta, A., Basilone, G., and Mazzola, S.:
Factors responsible for the differences in satellite-based chlorophyll a
concentration between the major global upwelling areas, Estuar. Coast. Shelf
Sci., 76, 775–786, <ext-link xlink:href="https://doi.org/10.1016/j.ecss.2007.08.005" ext-link-type="DOI">10.1016/j.ecss.2007.08.005</ext-link>, 2008.</mixed-citation></ref>
      <ref id="bib1.bib98"><label>98</label><?label 1?><mixed-citation>Pennington, J. T., Mahoney, K. L., Kuwahara, V. S., Kolber, D. D., Calienes,
R., and Chavez, F. P.: Primary production in the eastern tropical Pacific: A
review, Prog. Oceanogr., 69, 285–317,
<ext-link xlink:href="https://doi.org/10.1016/j.pocean.2006.03.012" ext-link-type="DOI">10.1016/j.pocean.2006.03.012</ext-link>, 2006.</mixed-citation></ref>
      <ref id="bib1.bib99"><label>99</label><?label 1?><mixed-citation>Penven, P., Echevin, V., Pasapera, J., Colas, F., and Tam, J.: Average
circulation, seasonal cycle, and mesoscale dynamics of the Peru Current
System: A modeling approach, J. Geophys. Res. C, 110, 1–21,
<ext-link xlink:href="https://doi.org/10.1029/2005JC002945" ext-link-type="DOI">10.1029/2005JC002945</ext-link>, 2005.</mixed-citation></ref>
      <ref id="bib1.bib100"><label>100</label><?label 1?><mixed-citation>Pitz, K., Truelove, N., Nye, C., Michisaki, R. P., and Chavez, F.: Environmental DNA (eDNA) 12S Metabarcoding Illumina MiSeq NGS PCR Protocol (Touchdown), protocols.io,
<ext-link xlink:href="https://doi.org/10.17504/protocols.io.bcppivmn" ext-link-type="DOI">10.17504/protocols.io.bcppivmn</ext-link>, 2020.</mixed-citation></ref>
      <ref id="bib1.bib101"><label>101</label><?label 1?><mixed-citation>Quast, C., Pruesse, E., Yilmaz, P., Gerken, J., Schweer, T., Yarza, P.,
Peplies, J., and Glöckner, F. O.: The SILVA ribosomal RNA gene database
project: Improved data processing and web-based tools, Nucl. Acids Res.,
41, 590–596, <ext-link xlink:href="https://doi.org/10.1093/nar/gks1219" ext-link-type="DOI">10.1093/nar/gks1219</ext-link>, 2013.</mixed-citation></ref>
      <ref id="bib1.bib102"><label>102</label><?label 1?><mixed-citation>R Core Team: R: A Language and Environment for Statistical Computing,
Vienna, Austria, <uri>http://www.R-project.org</uri> (last access: 21 February 2023), 2019.</mixed-citation></ref>
      <ref id="bib1.bib103"><label>103</label><?label 1?><mixed-citation>Riebesell, U., Bellerby, R. G. J., Grossart, H. P., and Thingstad, F.:
Mesocosm CO<inline-formula><mml:math id="M183" display="inline"><mml:msub><mml:mi/><mml:mn mathvariant="normal">2</mml:mn></mml:msub></mml:math></inline-formula> perturbation studies: From organism to community level,
Biogeosciences, 5, 1157–1164, <ext-link xlink:href="https://doi.org/10.5194/bg-5-1157-2008" ext-link-type="DOI">10.5194/bg-5-1157-2008</ext-link>, 2008.</mixed-citation></ref>
      <ref id="bib1.bib104"><label>104</label><?label 1?><mixed-citation>Riebesell, U., Czerny, J., Von Bröckel, K., Boxhammer, T.,
Büdenbender, J., Deckelnick, M., Fischer, M., Hoffmann, D., Krug, S. A.,
Lentz, U., Ludwig, A., Muche, R., and Schulz, K. G.: Technical Note: A
mobile sea-going mesocosm system – New opportunities for ocean change
research, Biogeosciences, 10, 1835–1847,
<ext-link xlink:href="https://doi.org/10.5194/bg-10-1835-2013" ext-link-type="DOI">10.5194/bg-10-1835-2013</ext-link>, 2013.</mixed-citation></ref>
      <ref id="bib1.bib105"><label>105</label><?label 1?><mixed-citation>Riemann, L., Steward, G. F., and Azam, F.: Erratum: Dynamics of bacterial
community composition and activity during a mesocosm diatom bloom,  Appl. Environ.
Microbiol., 66, 2282, <ext-link xlink:href="https://doi.org/10.1128/AEM.66.5.2282-2282.2000" ext-link-type="DOI">10.1128/AEM.66.5.2282-2282.2000</ext-link>, 2000.</mixed-citation></ref>
      <ref id="bib1.bib106"><label>106</label><?label 1?><mixed-citation>Rimet, F., Chaumeil, P., Keck, F., Kermarrec, L., Vasselon, V., Kahlert, M.,
Franc, A., and Bouchez, A.: R-Syst::diatom: An open-access and curated
barcode database for diatoms and freshwater monitoring, Database,
1–21, <ext-link xlink:href="https://doi.org/10.1093/database/baw016" ext-link-type="DOI">10.1093/database/baw016</ext-link>, 2016.</mixed-citation></ref>
      <ref id="bib1.bib107"><label>107</label><?label 1?><mixed-citation>
Robertson, D. A.: Possible functions of surface structure and size in some
planktonic eggs of marine fishes, New Zeal. J. Mar. Freshw. Res., 15,
147–153, 1981.</mixed-citation></ref>
      <ref id="bib1.bib108"><label>108</label><?label 1?><mixed-citation>Sandaa, R. A., Gómez-Consarnau, L., Pinhassi, J., Riemann, L., Malits,
A., Weinbauer, M. G., Gasol, J. M., and Thingstad, T. F.: Viral control of
bacterial biodiversity – Evidence from a nutrient-enriched marine mesocosm
experiment, Environ. Microbiol., 11, 2585–2597,
<ext-link xlink:href="https://doi.org/10.1111/j.1462-2920.2009.01983.x" ext-link-type="DOI">10.1111/j.1462-2920.2009.01983.x</ext-link>, 2009.</mixed-citation></ref>
      <ref id="bib1.bib109"><label>109</label><?label 1?><mixed-citation>Sassoubre, L. M., Yamahara, K. M., Gardner, L. D., Block, B. A., and Boehm,
A. B.: Quantification of Environmental DNA (eDNA) Shedding and Decay Rates
for Three Marine Fish, Environ. Sci. Technol., 50, 10456–10464,
<ext-link xlink:href="https://doi.org/10.1021/acs.est.6b03114" ext-link-type="DOI">10.1021/acs.est.6b03114</ext-link>, 2016.</mixed-citation></ref>
      <ref id="bib1.bib110"><label>110</label><?label 1?><mixed-citation>Schnell, I. B., Bohmann, K., and Gilbert, M. T. P.: Tag jumps illuminated –
reducing sequence-to-sample misidentifications in metabarcoding studies,
Mol. Ecol. Resour., 15, 1289–1303, <ext-link xlink:href="https://doi.org/10.1111/1755-0998.12402" ext-link-type="DOI">10.1111/1755-0998.12402</ext-link>,
2015.</mixed-citation></ref>
      <ref id="bib1.bib111"><label>111</label><?label 1?><mixed-citation>Schoenle, A., Hohlfeld, M., Rosse, M., Filz, P., Wylezich, C., Nitsche, F.,
and Arndt, H.: Global comparison of bicosoecid Cafeteria-like flagellates
from the deep ocean and surface waters, with reorganization of the family
Cafeteriaceae, Eur. J. Protistol., 73, 125665,
<ext-link xlink:href="https://doi.org/10.1016/j.ejop.2019.125665" ext-link-type="DOI">10.1016/j.ejop.2019.125665</ext-link>, 2020.</mixed-citation></ref>
      <ref id="bib1.bib112"><label>112</label><?label 1?><mixed-citation>
Silva, A. and Oliva, M.: Revisión sobre aspectos biológicos y de
cultivo del lenguado chileno (Paralichthys adspersus), Lat. Am. J. Aquat.
Res., 38, 377–386, 2010.</mixed-citation></ref>
      <ref id="bib1.bib113"><label>113</label><?label 1?><mixed-citation>Simmons, M. P., Sudek, S., Monier, A., Limardo, A. J., Jimenez, V., Perle,
C. R., Elrod, V. A., Pennington, J. T., and Worden, A. Z.: Abundance and
biogeography of picoprasinophyte ecotypes and other phytoplankton in the
eastern North Pacific Ocean, Appl. Environ. Microbiol., 82, 1693–1705,
<ext-link xlink:href="https://doi.org/10.1128/AEM.02730-15" ext-link-type="DOI">10.1128/AEM.02730-15</ext-link>, 2016.</mixed-citation></ref>
      <?pagebreak page1297?><ref id="bib1.bib114"><label>114</label><?label 1?><mixed-citation>Skjoldal, H. R., Wiebe, P. H., Postel, L., Knutsen, T., Kaartvedt, S., and
Sameoto, D. D.: Intercomparison of zooplankton (net) sampling systems:
Results from the ICES/GLOBEC sea-going workshop, Prog. Oceanogr., 108,
1–42, <ext-link xlink:href="https://doi.org/10.1016/j.pocean.2012.10.006" ext-link-type="DOI">10.1016/j.pocean.2012.10.006</ext-link>, 2013.</mixed-citation></ref>
      <ref id="bib1.bib115"><label>115</label><?label 1?><mixed-citation>Smayda, T. J.: Adaptations and selection of harmful and other dinoflagellate
species in upwelling systems. 2. Motility and migratory behaviour, Prog.
Oceanogr., 85, 71–91, <ext-link xlink:href="https://doi.org/10.1016/j.pocean.2010.02.005" ext-link-type="DOI">10.1016/j.pocean.2010.02.005</ext-link>, 2010.</mixed-citation></ref>
      <ref id="bib1.bib116"><label>116</label><?label 1?><mixed-citation>Smayda, T. J. and Trainer, V. L.: Dinoflagellate blooms in upwelling
systems: Seeding, variability, and contrasts with diatom bloom behaviour,
Prog. Oceanogr., 85, 92–107, <ext-link xlink:href="https://doi.org/10.1016/j.pocean.2010.02.006" ext-link-type="DOI">10.1016/j.pocean.2010.02.006</ext-link>,
2010.</mixed-citation></ref>
      <ref id="bib1.bib117"><label>117</label><?label 1?><mixed-citation>Spear-bernstein, L. and Miller, K. R.: Unique Location of the
Phycobiliprotein Light-Harvesting Pigment in the Cryptophyceae, J. Phycol.,
25, 412–419, <ext-link xlink:href="https://doi.org/10.1111/j.1529-8817.1989.tb00245.x" ext-link-type="DOI">10.1111/j.1529-8817.1989.tb00245.x</ext-link>, 1989.</mixed-citation></ref>
      <ref id="bib1.bib118"><label>118</label><?label 1?><mixed-citation>
Spilling, K., Olli, K., Lehtoranta, J., Kremp, A., Tedesco, L., Tamelander,
T., Klais, R., Peltonen, H., and Tamminen, T.: Shifting
diatom – dinoflagellate dominance during spring bloom in the Baltic Sea and
its potential effects on biogeochemical cycling, Front. Mar. Sci., 5, 327,
2018.</mixed-citation></ref>
      <ref id="bib1.bib119"><label>119</label><?label 1?><mixed-citation>Stewart, R. I. A., Dossena, M., Bohan, D. A., Jeppesen, E., Kordas, R. L.,
Ledger, M. E., Meerhoff, M., Moss, B., Mulder, C., Shurin, J. B., Suttle,
B., Thompson, R., Trimmer, M., and Woodward, G.: Mesocosm Experiments as a
Tool for Ecological Climate-Change Research, 1st Edn., Elsevier Ltd., 71–181, <ext-link xlink:href="https://doi.org/10.1016/B978-0-12-417199-2.00002-1" ext-link-type="DOI">10.1016/B978-0-12-417199-2.00002-1</ext-link>, 2013.</mixed-citation></ref>
      <ref id="bib1.bib120"><label>120</label><?label 1?><mixed-citation>Stoeck, T., Bass, D., Nebel, M., Christen, R., Jones, M. D. M., Breiner, H.
W., and Richards, T. A.: Multiple marker parallel tag environmental DNA
sequencing reveals a highly complex eukaryotic community in marine anoxic
water, Mol. Ecol., 19, 21–31,
<ext-link xlink:href="https://doi.org/10.1111/j.1365-294X.2009.04480.x" ext-link-type="DOI">10.1111/j.1365-294X.2009.04480.x</ext-link>, 2010.</mixed-citation></ref>
      <ref id="bib1.bib121"><label>121</label><?label 1?><mixed-citation>Sudek, S., Everroad, R. C., Gehman, A. L. M., Smith, J. M., Poirier, C. L.,
Chavez, F. P., and Worden, A. Z.: Cyanobacterial distributions along a
physico-chemical gradient in the Northeastern Pacific Ocean, Environ.
Microbiol., 17, 3692–3707, <ext-link xlink:href="https://doi.org/10.1111/1462-2920.12742" ext-link-type="DOI">10.1111/1462-2920.12742</ext-link>, 2015.</mixed-citation></ref>
      <ref id="bib1.bib122"><label>122</label><?label 1?><mixed-citation>Suffrian, K., Simonelli, P., Nejstgaard, J. C., Putzeys, S., Carotenuto, Y.,
and Antia, A. N.: Microzooplankton grazing and phytoplankton growth in
marine mesocosms with increased CO<inline-formula><mml:math id="M184" display="inline"><mml:msub><mml:mi/><mml:mn mathvariant="normal">2</mml:mn></mml:msub></mml:math></inline-formula> levels, Biogeosciences, 5, 1145–1156,
<ext-link xlink:href="https://doi.org/10.5194/bg-5-1145-2008" ext-link-type="DOI">10.5194/bg-5-1145-2008</ext-link>, 2008.</mixed-citation></ref>
      <ref id="bib1.bib123"><label>123</label><?label 1?><mixed-citation>
Taberlet, P., Coissac, E., Hajibabaei, M., and Rieseberg, L.: Environmental
DNA, Mol. Ecol., 21, 1789–1793, 2012.</mixed-citation></ref>
      <ref id="bib1.bib124"><label>124</label><?label 1?><mixed-citation>Taucher, J., Bach, L. T., Boxhammer, T., Nauendorf, A., Achterberg, E. P.,
Algueró-Muñiz, M., Arístegui, J., Czerny, J., Esposito, M.,
Guan, W., Haunost, M., Horn, H. G., Ludwig, A., Meyer, J., Spisla, C.,
Sswat, M., Stange, P., Riebesell, U., Aberle-Malzahn, N., Archer, S.,
Boersma, M., Broda, N., Büdenbender, J., Clemmesen, C., Deckelnick, M.,
Dittmar, T., Dolores-Gelado, M., Dörner, I., Fernández-Urruzola, I.,
Fiedler, M., Fischer, M., Fritsche, P., Gomez, M., Grossart, H. P., Hattich,
G., Hernández-Brito, J., Hernández-Hernández, N.,
Hernández-León, S., Hornick, T., Kolzenburg, R., Krebs, L.,
Kreuzburg, M., Lange, J. A. F., Lischka, S., Linsenbarth, S., Löscher,
C., Martínez, I., Montoto, T., Nachtigall, K., Osma-Prado, N., Packard,
T., Pansch, C., Posman, K., Ramírez-Bordón, B., Romero-Kutzner, V.,
Rummel, C., Salta, M., Martínez-Sánchez, I., Schröder, H.,
Sett, S., Singh, A., Suffrian, K., Tames-Espinosa, M., Voss, M., Walter, E.,
Wannicke, N., Xu, J., and Zark, M.: Influence of ocean acidification and
deep water upwelling on oligotrophic plankton communities in the subtropical
North Atlantic: Insights from an in situ mesocosm study, Front. Mar. Sci.,
4, 85, <ext-link xlink:href="https://doi.org/10.3389/fmars.2017.00085" ext-link-type="DOI">10.3389/fmars.2017.00085</ext-link>, 2017.</mixed-citation></ref>
      <ref id="bib1.bib125"><label>125</label><?label 1?><mixed-citation>Tillmann, U.: Interactions between planktonic microalgae and protozoan
grazers, J. Eukaryot. Microbiol., 51, 156–168,
<ext-link xlink:href="https://doi.org/10.1111/j.1550-7408.2004.tb00540.x" ext-link-type="DOI">10.1111/j.1550-7408.2004.tb00540.x</ext-link>, 2004.</mixed-citation></ref>
      <ref id="bib1.bib126"><label>126</label><?label 1?><mixed-citation>Trainer, V. L., Pitcher, G. C., Reguera, B., and Smayda, T. J.: The
distribution and impacts of harmful algal bloom species in eastern boundary
upwelling systems, Prog. Oceanogr., 85, 33–52,
<ext-link xlink:href="https://doi.org/10.1016/j.pocean.2010.02.003" ext-link-type="DOI">10.1016/j.pocean.2010.02.003</ext-link>, 2010.</mixed-citation></ref>
      <ref id="bib1.bib127"><label>127</label><?label 1?><mixed-citation>Tyrrell, T. and Merico, A.: Emiliania huxleyi: bloom observations and the
conditions that induce them, in: Coccolithophores, Springer Berlin,
Heidelberg,  75–97, <ext-link xlink:href="https://doi.org/10.1007/978-3-662-06278-4_4" ext-link-type="DOI">10.1007/978-3-662-06278-4_4</ext-link>, 2004.</mixed-citation></ref>
      <ref id="bib1.bib128"><label>128</label><?label 1?><mixed-citation>Ushio, M., Murata, K., Sado, T., Nishiumi, I., Takeshita, M., Iwasaki, W.,
and Miya, M.: Demonstration of the potential of environmental DNA as a tool
for the detection of avian species, Sci. Rep., 8, 1–10,
<ext-link xlink:href="https://doi.org/10.1038/s41598-018-22817-5" ext-link-type="DOI">10.1038/s41598-018-22817-5</ext-link>, 2018.</mixed-citation></ref>
      <ref id="bib1.bib129"><label>129</label><?label 1?><mixed-citation>Valentini, A., Taberlet, P., Miaud, C., Civade, R., Herder, J., Thomsen, P.
F., Bellemain, E., Besnard, A., Coissac, E., Boyer, F., Gaboriaud, C., Jean,
P., Poulet, N., Roset, N., Copp, G. H., Geniez, P., Pont, D., Argillier, C.,
Baudoin, J. M., Peroux, T., Crivelli, A. J., Olivier, A., Acqueberge, M., Le
Brun, M., Møller, P. R., Willerslev, E., and Dejean, T.: Next-generation
monitoring of aquatic biodiversity using environmental DNA metabarcoding,
Mol. Ecol., 25, 929–942, <ext-link xlink:href="https://doi.org/10.1111/mec.13428" ext-link-type="DOI">10.1111/mec.13428</ext-link>, 2016.</mixed-citation></ref>
      <ref id="bib1.bib130"><label>130</label><?label 1?><mixed-citation>
Vincent, F. J., Colin, S., Romac, S., Scalco, E., Bittner, L., Garcia, Y.,
Lopes, R. M., Dolan, J. R., Zingone, A., and De Vargas, C.: The epibiotic
life of the cosmopolitan diatom Fragilariopsis doliolus on heterotrophic
ciliates in the open ocean, ISME J., 12, 1094–1108, 2018.</mixed-citation></ref>
      <ref id="bib1.bib131"><label>131</label><?label 1?><mixed-citation>Walz, K., Yamahara, K., Michisaki, R. P., and Chavez, F. P.:   MBARI Environmental DNA (eDNA) extraction using Qiagen DNeasy Blood and Tissue Kit, protocols.io,
<ext-link xlink:href="https://doi.org/10.17504/protocols.io.xjufknw" ext-link-type="DOI">10.17504/protocols.io.xjufknw</ext-link>, 2019.</mixed-citation></ref>
      <ref id="bib1.bib132"><label>132</label><?label 1?><mixed-citation>Wear, E. K., Wilbanks, E. G., Nelson, C. E., and Carlson, C. A.: Primer
selection impacts specific population abundances but not community dynamics
in a monthly time-series 16S rRNA gene amplicon analysis of coastal marine
bacterioplankton, Environ. Microbiol., 20, 2709–2726,
<ext-link xlink:href="https://doi.org/10.1111/1462-2920.14091" ext-link-type="DOI">10.1111/1462-2920.14091</ext-link>, 2018.</mixed-citation></ref>
      <ref id="bib1.bib133"><label>133</label><?label 1?><mixed-citation>Wiebe, P. H. and Holland, W. R.: Plankton Patchiness: Effects on Repeated
Net Tows, Limnol. Oceanogr., 13, 315–321,
<ext-link xlink:href="https://doi.org/10.4319/lo.1968.13.2.0315" ext-link-type="DOI">10.4319/lo.1968.13.2.0315</ext-link>, 1968.</mixed-citation></ref>
      <ref id="bib1.bib134"><label>134</label><?label 1?><mixed-citation>Worden, A. Z., Nolan, J. K., and Palenik, B.: Assessing the dynamics and
ecology of marine picophytoplankton: The importance of the eukaryotic
component, Limnol. Oceanogr., 49, 168–179,
<ext-link xlink:href="https://doi.org/10.4319/lo.2004.49.1.0168" ext-link-type="DOI">10.4319/lo.2004.49.1.0168</ext-link>, 2004.</mixed-citation></ref>
      <ref id="bib1.bib135"><label>135</label><?label 1?><mixed-citation>Xu, L., Wu, Y. H., Jian, S. L., Wang, C. S., Wu, M., Cheng, L., and Xu, X.
W.: Pseudohongiella nitratireducens sp. Nov., isolated from seawater, and
emended description of the genus Pseudohongiella, Int. J. Syst. Evol.
Microbiol., 66, 5155–5160, <ext-link xlink:href="https://doi.org/10.1099/ijsem.0.001489" ext-link-type="DOI">10.1099/ijsem.0.001489</ext-link>, 2016.</mixed-citation></ref>
      <?pagebreak page1298?><ref id="bib1.bib136"><label>136</label><?label 1?><mixed-citation>Yang, C., Li, Y., Zhou, Y., Zheng, W., Tian, Y., and Zheng, T.: Bacterial
community dynamics during a bloom caused by Akashiwo sanguinea in the Xiamen
sea area, China, Harmful Algae, 20, 132–141,
<ext-link xlink:href="https://doi.org/10.1016/j.hal.2012.09.002" ext-link-type="DOI">10.1016/j.hal.2012.09.002</ext-link>, 2012.</mixed-citation></ref>
      <ref id="bib1.bib137"><label>137</label><?label 1?><mixed-citation>Yang, C., Li, Y., Zhou, B., Zhou, Y., Zheng, W., Tian, Y., Van Nostrand, J.
D., Wu, L., He, Z., Zhou, J., and Zheng, T.: Illumina sequencing-based
analysis of free-living bacterial community dynamics during an Akashiwo
sanguine bloom in Xiamen sea, China, Sci. Rep., 5, 1–11,
<ext-link xlink:href="https://doi.org/10.1038/srep08476" ext-link-type="DOI">10.1038/srep08476</ext-link>, 2015.
</mixed-citation></ref><?xmltex \hack{\newpage}?>
      <ref id="bib1.bib138"><label>138</label><?label 1?><mixed-citation>Zubkov, M. V.: Faster growth of the major prokaryotic versus eukaryotic CO<inline-formula><mml:math id="M185" display="inline"><mml:msub><mml:mi/><mml:mn mathvariant="normal">2</mml:mn></mml:msub></mml:math></inline-formula>
fixers in the oligotrophic ocean, Nat. Commun., 5, 1–6,
<ext-link xlink:href="https://doi.org/10.1038/ncomms4776" ext-link-type="DOI">10.1038/ncomms4776</ext-link>, 2014.</mixed-citation></ref>

  </ref-list></back>
    <!--<article-title-html>Ecological divergence of a mesocosm in an eastern boundary upwelling system assessed with multi-marker environmental DNA metabarcoding</article-title-html>
<abstract-html/>
<ref-html id="bib1.bib1"><label>1</label><mixed-citation>
      
Agarwala, R., Barrett, T., Beck, J., Benson, D. A., Bollin, C., Bolton, E.,
Bourexis, D., Brister, J. R., Bryant, S. H., Canese, K., Cavanaugh, M.,
Charowhas, C., Clark, K., Dondoshansky, I., Feolo, M., Fitzpatrick, L.,
Funk, K., Geer, L. Y., Gorelenkov, V., Graeff, A., Hlavina, W., Holmes, B.,
Johnson, M., Kattman, B., Khotomlianski, V., Kimchi, A., Kimelman, M.,
Kimura, M., Kitts, P., Klimke, W., Kotliarov, A., Krasnov, S., Kuznetsov,
A., Landrum, M. J., Landsman, D., Lathrop, S., Lee, J. M., Leubsdorf, C.,
Lu, Z., Madden, T. L., Marchler-Bauer, A., Malheiro, A., Meric, P.,
Karsch-Mizrachi, I., Mnev, A., Murphy, T., Orris, R., Ostell, J.,
O'Sullivan, C., Palanigobu, V., Panchenko, A. R., Phan, L., Pierov, B.,
Pruitt, K. D., Rodarmer, K., Sayers, E. W., Schneider, V., Schoch, C. L.,
Schuler, G. D., Sherry, S. T., Siyan, K., Soboleva, A., Soussov, V.,
Starchenko, G., Tatusova, T. A., Thibaud-Nissen, F., Todorov, K., Trawick,
B. W., Vakatov, D., Ward, M., Yaschenko, E., Zasypkin, A., and Zbicz, K.:
Database resources of the National Center for Biotechnology Information,
Nucl. Acids Res., 46, D8–D13, <a href="https://doi.org/10.1093/nar/gkx1095" target="_blank">https://doi.org/10.1093/nar/gkx1095</a>, 2018.

    </mixed-citation></ref-html>
<ref-html id="bib1.bib2"><label>2</label><mixed-citation>
      
Amaral-Zettler, L. A., McCliment, E. A., Ducklow, H. W., and Huse, S. M.: A
method for studying protistan diversity using massively parallel sequencing
of V9 hypervariable regions of small-subunit ribosomal RNA Genes, PLoS One,
4, 1–9, <a href="https://doi.org/10.1371/journal.pone.0006372" target="_blank">https://doi.org/10.1371/journal.pone.0006372</a>, 2009.

    </mixed-citation></ref-html>
<ref-html id="bib1.bib3"><label>3</label><mixed-citation>
      
Amaral-Zettler, L. A., Bauer, M., Berg-Lyons, D., Betley, J., Caporaso, J.
G., Ducklow, H. W., Fierer, N., Fraser, L., Gilbert, J. A., Gormley, N.,
Huntley, J., Huse, S. M., Jansson, J. K., Jarman, S. N., Knight, R., Lau, C.
L., and Walters, W. A.: EMP 18S Illumina Amplicon Protocol, protocols.io,
<a href="https://doi.org/10.17504/protocols.io.nuvdew6" target="_blank">https://doi.org/10.17504/protocols.io.nuvdew6</a>, 2018.

    </mixed-citation></ref-html>
<ref-html id="bib1.bib4"><label>4</label><mixed-citation>
      
Ayón, P., Swartzman, G., Bertrand, A., Gutiérrez, M., and Bertrand,
S.: Zooplankton and forage fish species off Peru: Large-scale bottom-up
forcing and local-scale depletion, Prog. Oceanogr., 79, 208–214,
<a href="https://doi.org/10.1016/j.pocean.2008.10.023" target="_blank">https://doi.org/10.1016/j.pocean.2008.10.023</a>, 2008.

    </mixed-citation></ref-html>
<ref-html id="bib1.bib5"><label>5</label><mixed-citation>
      
Bach, L. T., Paul, A. J., Boxhammer, T., von der Esch, E., Graco, M.,
Schulz, K. G., Achterberg, E., Aguayo, P., Arístegui, J., Ayón, P.,
Baños, I., Bernales, A., Boegeholz, A. S., Chavez, F., Chavez, G., Chen,
S. M., Doering, K., Filella, A., Fischer, M., Grasse, P., Haunost, M.,
Hennke, J., Hernández-Hernández, N., Hopwood, M., Igarza, M.,
Kalter, V., Kittu, L., Kohnert, P., Ledesma, J., Lieberum, C., Lischka, S.,
Löscher, C., Ludwig, A., Mendoza, U., Meyer, J., Meyer, J., Minutolo,
F., Cortes, J. O., Piiparinen, J., Sforna, C., Spilling, K., Sanchez, S.,
Spisla, C., Sswat, M., Moreira, M. Z., and Riebesell, U.: Factors
controlling plankton community production, export flux, and particulate
matter stoichiometry in the coastal upwelling system off Peru,
Biogeosciences, 17, 4831–4852, <a href="https://doi.org/10.5194/bg-17-4831-2020" target="_blank">https://doi.org/10.5194/bg-17-4831-2020</a>,
2020.

    </mixed-citation></ref-html>
<ref-html id="bib1.bib6"><label>6</label><mixed-citation>
      
Bachy, C., Wittmers, F., Muschiol, J., Hamilton, M., Henrissat, B., and
Worden, A. Z.: The Land-Sea Connection: Insights Into the Plant Lineage from
a Green Algal Perspective, Annu. Rev. Plant Biol., 73, 585–616,
<a href="https://doi.org/10.1146/annurev-arplant-071921-100530" target="_blank">https://doi.org/10.1146/annurev-arplant-071921-100530</a>, 2022.

    </mixed-citation></ref-html>
<ref-html id="bib1.bib7"><label>7</label><mixed-citation>
      
Baker, P., Minzlaff, U., Schoenle, A., Schwabe, E., Hohlfeld, M., Jeuck, A.,
Brenke, N., Prausse, D., Rothenbeck, M., Brix, S., Frutos, I., Jörger,
K. M., Neusser, T. P., Koppelmann, R., Devey, C., Brandt, A., and Arndt, H.:
Potential contribution of surface-dwelling Sargassum algae to deep-sea
ecosystems in the southern North Atlantic, Deep-Sea Res. Pt. II, 148, 21–34, <a href="https://doi.org/10.1016/j.dsr2.2017.10.002" target="_blank">https://doi.org/10.1016/j.dsr2.2017.10.002</a>, 2018.

    </mixed-citation></ref-html>
<ref-html id="bib1.bib8"><label>8</label><mixed-citation>
      
Berry, O., Bulman, C., Bunce, M., Coghlan, M., Murray, D. C., and Ward, R.
D.: Comparison of morphological and DNA metabarcoding analyses of diets in
exploited marine fishes, Mar. Ecol. Prog. Ser., 540, 167–181,
<a href="https://doi.org/10.3354/meps11524" target="_blank">https://doi.org/10.3354/meps11524</a>, 2015.

    </mixed-citation></ref-html>
<ref-html id="bib1.bib9"><label>9</label><mixed-citation>
      
Boenigk, J. and Arndt, H.: Particle handling during interception feeding by
four species of heterotrophic nanoflagellates, J. Eukaryot. Microbiol., 47,
350–358, <a href="https://doi.org/10.1111/j.1550-7408.2000.tb00060.x" target="_blank">https://doi.org/10.1111/j.1550-7408.2000.tb00060.x</a>, 2000.

    </mixed-citation></ref-html>
<ref-html id="bib1.bib10"><label>10</label><mixed-citation>
      
Bolyen, E., Rideout, J. R., Dillon, M. R., Bokulich, N. A., Abnet, C. C.,
Al-Ghalith, G. A., Alexander, H., Alm, E. J., Arumugam, M., Asnicar, F.,
Bai, Y., Bisanz, J. E., Bittinger, K., Brejnrod, A., Brislawn, C. J., Brown,
C. T., Callahan, B. J., Caraballo-Rodríguez, A. M., Chase, J., Cope, E.
K., Da Silva, R., Diener, C., Dorrestein, P. C., Douglas, G. M., Durall, D.
M., Duvallet, C., Edwardson, C. F., Ernst, M., Estaki, M., Fouquier, J.,
Gauglitz, J. M., Gibbons, S. M., Gibson, D. L., Gonzalez, A., Gorlick, K.,
Guo, J., Hillmann, B., Holmes, S., Holste, H., Huttenhower, C., Huttley, G.
A., Janssen, S., Jarmusch, A. K., Jiang, L., Kaehler, B. D., Kang, K. Bin,
Keefe, C. R., Keim, P., Kelley, S. T., Knights, D., Koester, I., Kosciolek,
T., Kreps, J., Langille, M. G. I., Lee, J., Ley, R., Liu, Y. X., Loftfield,
E., Lozupone, C., Maher, M., Marotz, C., Martin, B. D., McDonald, D.,
McIver, L. J., Melnik, A. V., Metcalf, J. L., Morgan, S. C., Morton, J. T.,
Naimey, A. T., Navas-Molina, J. A., Nothias, L. F., Orchanian, S. B.,
Pearson, T., Peoples, S. L., Petras, D., Preuss, M. L., Pruesse, E.,
Rasmussen, L. B., Rivers, A., Robeson, M. S., Rosenthal, P., Segata, N.,
Shaffer, M., Shiffer, A., Sinha, R., Song, S. J., Spear, J. R., Swafford, A.
D., Thompson, L. R., Torres, P. J., Trinh, P., Tripathi, A., Turnbaugh, P.
J., Ul-Hasan, S., van der Hooft, J. J. J., Vargas, F., Vázquez-Baeza,
Y., Vogtmann, E., von Hippel, M., Walters, W.,
Wan, Y.,
Wang, M.,
Warren, J.,
Weber, K. C.,
Williamson, C. H. D.,
Willis, A. D.,
Xu, Z. Z.,
Zaneveld, J. R.,
Zhang, Y.,
Zhu, Q.,
Knight, R.,
and Caporaso, J. G.: Reproducible, interactive,
scalable and extensible microbiome data science using QIIME 2, Nat.
Biotechnol., 37, 852–857, <a href="https://doi.org/10.1038/s41587-019-0209-9" target="_blank">https://doi.org/10.1038/s41587-019-0209-9</a>, 2019.

    </mixed-citation></ref-html>
<ref-html id="bib1.bib11"><label>11</label><mixed-citation>
      
Boussarie, G., Bakker, J., Wangensteen, O. S., Mariani, S., Bonnin, L.,
Juhel, J. B., Kiszka, J. J., Kulbicki, M., Manel, S., Robbins, W. D.,
Vigliola, L., and Mouillot, D.: Environmental DNA illuminates the dark
diversity of sharks, Sci. Adv., 4, 5, <a href="https://doi.org/10.1126/sciadv.aap9661" target="_blank">https://doi.org/10.1126/sciadv.aap9661</a>,
2018.

    </mixed-citation></ref-html>
<ref-html id="bib1.bib12"><label>12</label><mixed-citation>
      
Buchan, A., LeCleir, G. R., Gulvik, C. A., and González, J. M.: Master
recyclers: features and functions of bacteria associated with phytoplankton
blooms, Nat. Rev. Microbiol., 12, 686–698, <a href="https://doi.org/10.1038/nrmicro3326" target="_blank">https://doi.org/10.1038/nrmicro3326</a>,   2014.

    </mixed-citation></ref-html>
<ref-html id="bib1.bib13"><label>13</label><mixed-citation>
      
Callahan, B. J., McMurdie, P. J., Rosen, M. J., Han, A. W., Johnson, A. J.
A., and Holmes, S. P.: DADA2: High-resolution sample inference from Illumina
amplicon data, Nat. Methods, 13, 581–583,
<a href="https://doi.org/10.1038/nmeth.3869" target="_blank">https://doi.org/10.1038/nmeth.3869</a>, 2016.

    </mixed-citation></ref-html>
<ref-html id="bib1.bib14"><label>14</label><mixed-citation>
      
Camacho, C., Coulouris, G., Avagyan, V., Ma, N., Papadopoulos, J., Bealer,
K., and Madden, T. L.: BLAST+: Architecture and applications, BMC
Bioinformatics, 10, 1–9, <a href="https://doi.org/10.1186/1471-2105-10-421" target="_blank">https://doi.org/10.1186/1471-2105-10-421</a>, 2009.

    </mixed-citation></ref-html>
<ref-html id="bib1.bib15"><label>15</label><mixed-citation>
      
Carr, M. E.: Estimation of potential productivity in Eastern Boundary
Currents using remote sensing, Deep-Sea Res. Pt. II, 49,
59–80, <a href="https://doi.org/10.1016/S0967-0645(01)00094-7" target="_blank">https://doi.org/10.1016/S0967-0645(01)00094-7</a>, 2001.

    </mixed-citation></ref-html>
<ref-html id="bib1.bib16"><label>16</label><mixed-citation>
      
Carr, M. E. and Kearns, E. J.: Production regimes in four Eastern Boundary
Current systems, Deep-Sea Res. Pt. II, 50, 3199–3221,
<a href="https://doi.org/10.1016/j.dsr2.2003.07.015" target="_blank">https://doi.org/10.1016/j.dsr2.2003.07.015</a>, 2003.

    </mixed-citation></ref-html>
<ref-html id="bib1.bib17"><label>17</label><mixed-citation>
      
Chavez, F. P. and Messié, M.: A comparison of Eastern Boundary Upwelling
Ecosystems, Prog. Oceanogr., 83, 80–96,
<a href="https://doi.org/10.1016/j.pocean.2009.07.032" target="_blank">https://doi.org/10.1016/j.pocean.2009.07.032</a>, 2009.

    </mixed-citation></ref-html>
<ref-html id="bib1.bib18"><label>18</label><mixed-citation>
      
Chavez, F. P., Pennington, J. T., Michisaki, R. P., Blum, M., Chavez, G. M.,
Friederich, J., Jones, B., Herlien, R., Kieft, B., and Hobson, B.: Climate
variability and change: response of a coastal ocean ecosystem, Oceanography,
30, 128–145, 2017.

    </mixed-citation></ref-html>
<ref-html id="bib1.bib19"><label>19</label><mixed-citation>
      
Choi, C. J., Jimenez, V., Needham, D. M., Poirier, C., Bachy, C., Alexander, H., Wilken, S., Chavez, F. P., Sudek, S., Giovannoni, S. J., and Worden, A. Z.: Seasonal and geographical transitions in eukaryotic phytoplankton
community structure in the Atlantic and Pacific Oceans, Front. Microbiol., 11,  542372, <a href="https://doi.org/10.3389/fmicb.2020.542372" target="_blank">https://doi.org/10.3389/fmicb.2020.542372</a>, 2020.

    </mixed-citation></ref-html>
<ref-html id="bib1.bib20"><label>20</label><mixed-citation>
      
Closek, C., Djurhuus, A., Pitz, K., Kelly, R., Michisaki, R., Walz, K., Starks, H., Chavez, F., Boehm, A., and Breitbart, M.: Environmental DNA (eDNA) 18S metabarcoding Illumina MiSeq NGS PCR Protocol, protocols.io,
<a href="https://doi.org/10.17504/protocols.io.n2vdge6" target="_blank">https://doi.org/10.17504/protocols.io.n2vdge6</a>, 2018a.

    </mixed-citation></ref-html>
<ref-html id="bib1.bib21"><label>21</label><mixed-citation>
      
Closek, C., Djurhuus, A., Pitz, K., Kelly, R., Michisaki, R., Walz, K., Starks, H., Chavez, F., Boehm, A., and Breitbart, M.: Environmental DNA (eDNA) COI metabarcoding Illumina MiSeq NGS PCR Protocol, protocols.io,
<a href="https://doi.org/10.17504/protocols.io.mwnc7de" target="_blank">https://doi.org/10.17504/protocols.io.mwnc7de</a>, 2018b.

    </mixed-citation></ref-html>
<ref-html id="bib1.bib22"><label>22</label><mixed-citation>
      
Coats, D. W.: <i>Duboscquella cachoni</i> N. Sp., a Parasitic Dinoflagellate Lethal
to Its Tintinnine Host <i>Eutintinnus pectinis</i> 1, J. Protozool., 35, 607–617,
1988.

    </mixed-citation></ref-html>
<ref-html id="bib1.bib23"><label>23</label><mixed-citation>
      
Crouch, E. M., Heilmann-Clausen, C., Brinkhuis, H., Morgans, H. E. G.,
Rogers, K. M., Egger, H., and Schmitz, B.: Global dinoflagellate event
associated with the late Paleocene thermal maximum, Geology, 29, 315–318,
<a href="https://doi.org/10.1130/0091-7613(2001)029&lt;0315:GDEAWT&gt;2.0.CO;2" target="_blank">https://doi.org/10.1130/0091-7613(2001)029&lt;0315:GDEAWT&gt;2.0.CO;2</a>, 2001.

    </mixed-citation></ref-html>
<ref-html id="bib1.bib24"><label>24</label><mixed-citation>
      
Daims, H., Brühl, A., Amann, R., Schleifer, K. H., and Wagner, M.: The
domain-specific probe EUB338 is insufficient for the detection of all
bacteria: Development and evaluation of a more comprehensive probe set,
Syst. Appl. Microbiol., 22, 434–444,
<a href="https://doi.org/10.1016/S0723-2020(99)80053-8" target="_blank">https://doi.org/10.1016/S0723-2020(99)80053-8</a>, 1999.

    </mixed-citation></ref-html>
<ref-html id="bib1.bib25"><label>25</label><mixed-citation>
      
Decelle, J., Romac, S., Stern, R. F., Bendif, E. M., Zingone, A., Audic, S.,
Guiry, M. D., Guillou, L., Tessier, D., Le Gall, F., Gourvil, P., Dos
Santos, A. L., Probert, I., Vaulot, D., de Vargas, C., and Christen, R.:
PhytoREF: A reference database of the plastidial 16S rRNA gene of
photosynthetic eukaryotes with curated taxonomy, Mol. Ecol. Resour., 15,
1435–1445, <a href="https://doi.org/10.1111/1755-0998.12401" target="_blank">https://doi.org/10.1111/1755-0998.12401</a>, 2015.

    </mixed-citation></ref-html>
<ref-html id="bib1.bib26"><label>26</label><mixed-citation>
      
De La Iglesia, R., Echenique-Subiabre, I., Rodríguez-Marconi, S.,
Espinoza, J. P., Von Dassow, P., Ulloa, O., and Trefault, N.: Distinct
oxygen environments shape picoeukaryote assemblages thriving oxygen minimum
zone waters off central Chile, J. Plankton Res., 42, 514–529,
<a href="https://doi.org/10.1093/plankt/fbaa036" target="_blank">https://doi.org/10.1093/plankt/fbaa036</a>, 2020.

    </mixed-citation></ref-html>
<ref-html id="bib1.bib27"><label>27</label><mixed-citation>
      
Didion, J. P., Martin, M., and Collins, F. S.: Atropos: Specific, sensitive,
and speedy trimming of sequencing reads, PeerJ, 2017, 1–19,
<a href="https://doi.org/10.7717/peerj.3720" target="_blank">https://doi.org/10.7717/peerj.3720</a>, 2017.

    </mixed-citation></ref-html>
<ref-html id="bib1.bib28"><label>28</label><mixed-citation>
      
Djurhuus, A., Pitz, K., Sawaya, N. A., Rojas-Márquez, J., Michaud, B.,
Montes, E., Muller-Karger, F., and Breitbart, M.: Evaluation of marine
zooplankton community structure through environmental DNA metabarcoding,
Limnol. Oceanogr. Method., 16, 209–221, <a href="https://doi.org/10.1002/lom3.10237" target="_blank">https://doi.org/10.1002/lom3.10237</a>,
2018.

    </mixed-citation></ref-html>
<ref-html id="bib1.bib29"><label>29</label><mixed-citation>
      
Du, X., Peterson, W., McCulloch, A., and Liu, G.: An unusual bloom of the
dinoflagellate Akashiwo sanguinea off the central Oregon, USA, coast in
autumn 2009, Harmful Algae, 10, 784–793,
<a href="https://doi.org/10.1016/j.hal.2011.06.011" target="_blank">https://doi.org/10.1016/j.hal.2011.06.011</a>, 2011.

    </mixed-citation></ref-html>
<ref-html id="bib1.bib30"><label>30</label><mixed-citation>
      
Duffy, D. C.: The foraging ecology of Peruvian seabirds, Auk, 100, 800–810,
1983.

    </mixed-citation></ref-html>
<ref-html id="bib1.bib31"><label>31</label><mixed-citation>
      
Dugdale, R. C., Goering, J. J., Barber, R. T., Smith, R. L., and Packard, T.
T.: Denitrification and hydrogen sulfide in the Peru upwelling region during
1976, Deep-Sea Res., 24, 601–608, 1977.

    </mixed-citation></ref-html>
<ref-html id="bib1.bib32"><label>32</label><mixed-citation>
      
Dupont, C. L., Rusch, D. B., Yooseph, S., Lombardo, M. J., Alexander
Richter, R., Valas, R., Novotny, M., Yee-Greenbaum, J., Selengut, J. D.,
Haft, D. H., Halpern, A. L., Lasken, R. S., Nealson, K., Friedman, R., and
Craig Venter, J.: Genomic insights to SAR86, an abundant and uncultivated
marine bacterial lineage, ISME J., 6, 1186–1199,
<a href="https://doi.org/10.1038/ismej.2011.189" target="_blank">https://doi.org/10.1038/ismej.2011.189</a>, 2012.

    </mixed-citation></ref-html>
<ref-html id="bib1.bib33"><label>33</label><mixed-citation>
      
Echevin, V., Puillat, I., Grados, C., and Dewitte, B.: Seasonal and
mesoscale variability in the Peru Upwelling System from in situ data during
the years 2000 to 2004, Gayana (Concepción), 68, 167–173,
<a href="https://doi.org/10.4067/s0717-65382004000200031" target="_blank">https://doi.org/10.4067/s0717-65382004000200031</a>, 2004.

    </mixed-citation></ref-html>
<ref-html id="bib1.bib34"><label>34</label><mixed-citation>
      
Edvarsen, B. and Paasche, E.: Bloom dynamics and physiology of Prymnesium
and Chrysochromulina, Physiol. Ecol. Harmful Algal Bloom., 41, 193–208,
1998.

    </mixed-citation></ref-html>
<ref-html id="bib1.bib35"><label>35</label><mixed-citation>
      
Espinoza, P. and Bertrand, A.: Revisiting Peruvian anchovy (Engraulis
ringens) trophodynamics provides a new vision of the Humboldt Current
system, Prog. Oceanogr., 79, 215–227,
<a href="https://doi.org/10.1016/j.pocean.2008.10.022" target="_blank">https://doi.org/10.1016/j.pocean.2008.10.022</a>, 2008.

    </mixed-citation></ref-html>
<ref-html id="bib1.bib36"><label>36</label><mixed-citation>
      
Evans, N. T., Olds, B. P., Renshaw, M. A., Turner, C. R., Li, Y., Jerde, C.
L., Mahon, A. R., Pfrender, M. E., Lamberti, G. A., and Lodge, D. M.:
Quantification of mesocosm fish and amphibian species diversity via
environmental DNA metabarcoding, Mol. Ecol. Resour., 16, 29–41,
<a href="https://doi.org/10.1111/1755-0998.12433" target="_blank">https://doi.org/10.1111/1755-0998.12433</a>, 2016.

    </mixed-citation></ref-html>
<ref-html id="bib1.bib37"><label>37</label><mixed-citation>
      
Ferrari, B. C., Binnerup, S. J., and Gillings, M.: Microcolony cultivation
on a soil substrate membrane system selects for previously uncultured soil
bacteria, Appl. Environ. Microbiol., 71, 8714–8720,
<a href="https://doi.org/10.1128/AEM.71.12.8714-8720.2005" target="_blank">https://doi.org/10.1128/AEM.71.12.8714-8720.2005</a>, 2005.

    </mixed-citation></ref-html>
<ref-html id="bib1.bib38"><label>38</label><mixed-citation>
      
Folmer, O., Hoeh, W. R., Black, M. B., and Vrijenhoek, R. C.: Conserved
primers for PCR amplification of mitochondrial DNA from different
invertebrate phyla, Mol. Mar. Biol. Biotechnol., 3, 294–299, 1994.

    </mixed-citation></ref-html>
<ref-html id="bib1.bib39"><label>39</label><mixed-citation>
      
Garreaud, R. D.: A plausible atmospheric trigger for the 2017 coastal El
Niño, Int. J. Climatol., 38, e1296–e1302,
<a href="https://doi.org/10.1002/joc.5426" target="_blank">https://doi.org/10.1002/joc.5426</a>, 2018.

    </mixed-citation></ref-html>
<ref-html id="bib1.bib40"><label>40</label><mixed-citation>
      
Giovannoni, S. J., Britschgi, T. B., Moyer, C. L., and Field, K. G.: Genetic
diversity in Sargasso Sea bacterioplankton, Nature, 345, 60–63,
<a href="https://doi.org/10.1038/345060a0" target="_blank">https://doi.org/10.1038/345060a0</a>, 1990.

    </mixed-citation></ref-html>
<ref-html id="bib1.bib41"><label>41</label><mixed-citation>
      
Gold, Z., Curd, E., Goodwin, K., Choi, E., Frable, B., Thompson, A., Burton,
R., Kacev, D., and Barber, P.: Improving metabarcoding taxonomic assignment: A case study of fishes in a large marine ecosystem, Mol. Ecol. Resour., 21, 2546–2564,
<a href="https://doi.org/10.22541/au.161407483.33882798/v1" target="_blank">https://doi.org/10.22541/au.161407483.33882798/v1</a>, 2021.

    </mixed-citation></ref-html>
<ref-html id="bib1.bib42"><label>42</label><mixed-citation>
      
Gómez, F.: On the consortium of the tintinnid Eutintinnus and the diatom
Chaetoceros in the Pacific Ocean, Mar. Biol., 151, 1899–1906,
<a href="https://doi.org/10.1007/s00227-007-0625-0" target="_blank">https://doi.org/10.1007/s00227-007-0625-0</a>, 2007.

    </mixed-citation></ref-html>
<ref-html id="bib1.bib43"><label>43</label><mixed-citation>
      
Gómez, F.: Symbiotic interactions between ciliates (Ciliophora) and
diatoms (Bacillariophyceae), Rev. Biol. Trop., 68,  2020.

    </mixed-citation></ref-html>
<ref-html id="bib1.bib44"><label>44</label><mixed-citation>
      
Graco, M. I., Purca, S., Dewitte, B., Castro, C. G., Morón, O., Ledesma,
J., Flores, G., and Gutiérrez, D.: The OMZ and nutrient features as a
signature of interannual and low-frequency variability in the Peruvian
upwelling system, Biogeosciences, 14, 4601–4617,
<a href="https://doi.org/10.5194/bg-14-4601-2017" target="_blank">https://doi.org/10.5194/bg-14-4601-2017</a>, 2017.

    </mixed-citation></ref-html>
<ref-html id="bib1.bib45"><label>45</label><mixed-citation>
      
Gruber, N.: Warming up, turning sour, losing breath: Ocean biogeochemistry
under global change, Philos. T. R. Soc. A, 369,
1980–1996, <a href="https://doi.org/10.1098/rsta.2011.0003" target="_blank">https://doi.org/10.1098/rsta.2011.0003</a>, 2011.

    </mixed-citation></ref-html>
<ref-html id="bib1.bib46"><label>46</label><mixed-citation>
      
Guillou, L., Viprey, M., Chambouvet, A., Welsh, R. M., Kirkham, A. R.,
Massana, R., Scanlan, D. J., and Worden, A. Z.: Widespread occurrence and
genetic diversity of marine parasitoids belonging to Syndiniales
(Alveolata), Environ. Microbiol., 10, 3349–3365,
<a href="https://doi.org/10.1111/j.1462-2920.2008.01731.x" target="_blank">https://doi.org/10.1111/j.1462-2920.2008.01731.x</a>, 2008.

    </mixed-citation></ref-html>
<ref-html id="bib1.bib47"><label>47</label><mixed-citation>
      
Hare, J. A., Walsh, H. J., and Wuenschel, M. J.: Sinking rates of late-stage
fish larvae: Implications for larval ingress into estuarine nursery
habitats, J. Exp. Mar. Bio. Ecol., 330, 493–504,
<a href="https://doi.org/10.1016/j.jembe.2005.09.011" target="_blank">https://doi.org/10.1016/j.jembe.2005.09.011</a>, 2006.

    </mixed-citation></ref-html>
<ref-html id="bib1.bib48"><label>48</label><mixed-citation>
      
Harvey, J. B. J., Johnson, S. B., Fisher, J. L., Peterson, W. T., and
Vrijenhoek, R. C.: Comparison of morphological and next generation DNA
sequencing methods for assessing zooplankton assemblages, J. Exp. Mar. Biol.
Ecol., 487, 113–126, <a href="https://doi.org/10.1016/j.jembe.2016.12.002" target="_blank">https://doi.org/10.1016/j.jembe.2016.12.002</a>, 2017.

    </mixed-citation></ref-html>
<ref-html id="bib1.bib49"><label>49</label><mixed-citation>
      
Hattenrath-Lehmann, T. K. and Gobler, C. J.: Identification of unique
microbiomes associated with harmful algal blooms caused by Alexandrium
fundyense and Dinophysis acuminata, Harmful Algae, 68, 17–30,
<a href="https://doi.org/10.1016/j.hal.2017.07.003" target="_blank">https://doi.org/10.1016/j.hal.2017.07.003</a>, 2017.

    </mixed-citation></ref-html>
<ref-html id="bib1.bib50"><label>50</label><mixed-citation>
      
He, X., McLean, J. S., Edlund, A., Yooseph, S., Hall, A. P., Liu, S. Y.,
Dorrestein, P. C., Esquenazi, E., Hunter, R. C., Cheng, G., Nelson, K. E.,
Lux, R., and Shi, W.: Cultivation of a human-associated TM7 phylotype
reveals a reduced genome and epibiotic parasitic lifestyle, P. Natl.
Acad. Sci. USA, 112, 244–249, <a href="https://doi.org/10.1073/pnas.1419038112" target="_blank">https://doi.org/10.1073/pnas.1419038112</a>,
2015.

    </mixed-citation></ref-html>
<ref-html id="bib1.bib51"><label>51</label><mixed-citation>
      
Herring, S. C., Christidis, N., Hoell, A., Hoerling, M. P., and Stott, P.
A.: Explaining Extreme Events of 2017 from a Climate Perspective, Bull. Am.
Meteorol. Soc., 100, S1–S117,
<a href="https://doi.org/10.1175/bams-explainingextremeevents2017.1" target="_blank">https://doi.org/10.1175/bams-explainingextremeevents2017.1</a>, 2019.

    </mixed-citation></ref-html>
<ref-html id="bib1.bib52"><label>52</label><mixed-citation>
      
Hird, S. M., Sánchez, C., Carstens, B. C., and Brumfield, R. T.:
Comparative gut microbiota of 59 neotropical bird species, Front.
Microbiol., 6, 1403, <a href="https://doi.org/10.3389/fmicb.2015.01403" target="_blank">https://doi.org/10.3389/fmicb.2015.01403</a>, 2015.

    </mixed-citation></ref-html>
<ref-html id="bib1.bib53"><label>53</label><mixed-citation>
      
Hitchcock, J. N., Mitrovic, S. M., Hadwen, W. L., Roelke, D. L., Growns, I.
O., and Rohlfs, A. M.: Terrestrial dissolved organic carbon subsidizes
estuarine zooplankton: An in situ mesocosm study, Limnol. Oceanogr., 61,
254–267, <a href="https://doi.org/10.1002/lno.10207" target="_blank">https://doi.org/10.1002/lno.10207</a>, 2016.

    </mixed-citation></ref-html>
<ref-html id="bib1.bib54"><label>54</label><mixed-citation>
      
Hugenholtz, P., Tyson, G. W., Webb, R. I., Wagner, A. M., and Blackall, L.
L.: Investigation of candidate division TM7, a recently recognized major
lineage of the domain Bacteria, with no known pure-culture representatives,
Appl. Environ. Microbiol., 67, 411–419,
<a href="https://doi.org/10.1128/AEM.67.1.411-419.2001" target="_blank">https://doi.org/10.1128/AEM.67.1.411-419.2001</a>, 2001.

    </mixed-citation></ref-html>
<ref-html id="bib1.bib55"><label>55</label><mixed-citation>
      
Huson, D. H., Beier, S., Flade, I., Górska, A., El-Hadidi, M., Mitra,
S., Ruscheweyh, H. J., and Tappu, R.: MEGAN Community Edition – Interactive
Exploration and Analysis of Large-Scale Microbiome Sequencing Data, PLoS
Comput. Biol., 12, 1–12, <a href="https://doi.org/10.1371/journal.pcbi.1004957" target="_blank">https://doi.org/10.1371/journal.pcbi.1004957</a>,
2016.

    </mixed-citation></ref-html>
<ref-html id="bib1.bib56"><label>56</label><mixed-citation>
      
Huyer, A., Knoll, M., Paluszkiewicz, T., and Smith, R. L.: The Peru
Undercurrent: a study in variability, Deep-Sea Res. Pt. A, 38, S247–S271, <a href="https://doi.org/10.1016/s0198-0149(12)80012-4" target="_blank">https://doi.org/10.1016/s0198-0149(12)80012-4</a>, 1991.

    </mixed-citation></ref-html>
<ref-html id="bib1.bib57"><label>57</label><mixed-citation>
      
Ianora, A.: Copepod life history traits in subtemperate regions, J. Mar.
Syst., 15, 337–349, <a href="https://doi.org/10.1016/S0924-7963(97)00085-7" target="_blank">https://doi.org/10.1016/S0924-7963(97)00085-7</a>, 1998.

    </mixed-citation></ref-html>
<ref-html id="bib1.bib58"><label>58</label><mixed-citation>
      
Pachauri, R. K., Allen, M. R., Barros, V. R., Broome, J., Cramer, W., Christ, R., Church, J. A., Clarke, L., Dahe, Q., Dasgupta, P., and Dubash, N. K.: Climate change 2014: synthesis report. Contribution of Working Groups I, II and III to the fifth assessment report of the Intergovernmental Panel on Climate Change, p. 151, IPCC, 2014.

    </mixed-citation></ref-html>
<ref-html id="bib1.bib59"><label>59</label><mixed-citation>
      
Jaffe, A. L., Thomas, A. D., He, C., Keren, R., Valentin-Alvarado, L. E.,
Munk, P., Bouma-Gregson, K., Farag, I. F., Amano, Y., Sachdeva, R., West, P.
T., and Banfield, J. F.: Patterns of gene content and co-occurrence constrain the evolutionary path toward animal association in Candidate Phyla Radiation Bacteria, MBio, 12, e00521-21, <a href="https://doi.org/10.1128/mBio.00521-21" target="_blank">https://doi.org/10.1128/mBio.00521-21</a>, 2021.

    </mixed-citation></ref-html>
<ref-html id="bib1.bib60"><label>60</label><mixed-citation>
      
Kahru, M., Michell, B. G., Diaz, A., and Miura, M.: MODIS detects a
devastating algal bloom in Paracas Bay, Peru, Eos, Trans. Am. Geophys.
Union, 85, 465–472, 2004.

    </mixed-citation></ref-html>
<ref-html id="bib1.bib61"><label>61</label><mixed-citation>
      
Kelly, R. P., Port, J. A., Yamahara, K. M., and Crowder, L. B.: Using
environmental DNA to census marine fishes in a large mesocosm, PLoS One, 9, e86175,
<a href="https://doi.org/10.1371/journal.pone.0086175" target="_blank">https://doi.org/10.1371/journal.pone.0086175</a>, 2014.

    </mixed-citation></ref-html>
<ref-html id="bib1.bib62"><label>62</label><mixed-citation>
      
Kim, S. and Park, M. G.: Paulinella longichromatophora sp. nov., a New
Marine Photosynthetic Testate Amoeba Containing a Chromatophore, Protist,
167, 1–12, <a href="https://doi.org/10.1016/j.protis.2015.11.003" target="_blank">https://doi.org/10.1016/j.protis.2015.11.003</a>, 2016.

    </mixed-citation></ref-html>
<ref-html id="bib1.bib63"><label>63</label><mixed-citation>
      
Kolody, B. C., McCrow, J. P., Allen, L. Z., Aylward, F. O., Fontanez, K. M.,
Moustafa, A., Moniruzzaman, M., Chavez, F. P., Scholin, C. A., Allen, E. E.,
Worden, A. Z., Delong, E. F., and Allen, A. E.: Diel transcriptional
response of a California Current plankton microbiome to light, low iron, and
enduring viral infection, ISME J., 13, 2817–2833,
<a href="https://doi.org/10.1038/s41396-019-0472-2" target="_blank">https://doi.org/10.1038/s41396-019-0472-2</a>, 2019.

    </mixed-citation></ref-html>
<ref-html id="bib1.bib64"><label>64</label><mixed-citation>
      
Koumandou, V. L., Nisbet, R. E. R., Barbrook, A. C., and Howe, C. J.:
Dinoflagellate chloroplasts – Where have all the genes gone?, Trends Genet.,
20, 261–267, <a href="https://doi.org/10.1016/j.tig.2004.03.008" target="_blank">https://doi.org/10.1016/j.tig.2004.03.008</a>, 2004.

    </mixed-citation></ref-html>
<ref-html id="bib1.bib65"><label>65</label><mixed-citation>
      
Kudela, R. M., Lane, J. Q., and Cochlan, W. P.: The potential role of
anthropogenically derived nitrogen in the growth of harmful algae in
California, USA, Harmful Algae, 8, 103–110,
<a href="https://doi.org/10.1016/j.hal.2008.08.019" target="_blank">https://doi.org/10.1016/j.hal.2008.08.019</a>, 2008.

    </mixed-citation></ref-html>
<ref-html id="bib1.bib66"><label>66</label><mixed-citation>
      
Kudela, R. M., Seeyave, S., and Cochlan, W. P.: The role of nutrients in
regulation and promotion of harmful algal blooms in upwelling systems, Prog.
Oceanogr., 85, 122–135, <a href="https://doi.org/10.1016/j.pocean.2010.02.008" target="_blank">https://doi.org/10.1016/j.pocean.2010.02.008</a>, 2010.

    </mixed-citation></ref-html>
<ref-html id="bib1.bib67"><label>67</label><mixed-citation>
      
Kuehbacher, T., Rehman, A., Lepage, P., Hellmig, S., Fölsch, U. R.,
Schreiber, S., and Ott, S. J.: Intestinal TM7 bacterial phylogenies in
active inflammatory bowel disease, J. Med. Microbiol., 57, 1569–1576,
<a href="https://doi.org/10.1099/jmm.0.47719-0" target="_blank">https://doi.org/10.1099/jmm.0.47719-0</a>, 2008.

    </mixed-citation></ref-html>
<ref-html id="bib1.bib68"><label>68</label><mixed-citation>
      
Lamb, J. S., Satgé, Y. G., and Jodice, P. G. R.: Diet composition and
provisioning rates of nestlings determine reproductive success in a
subtropical seabird, Mar. Ecol. Prog. Ser., 581, 149–164,
<a href="https://doi.org/10.3354/meps12301" target="_blank">https://doi.org/10.3354/meps12301</a>, 2017.

    </mixed-citation></ref-html>
<ref-html id="bib1.bib69"><label>69</label><mixed-citation>
      
Lemos, L. N., Medeiros, J. D., Dini-Andreote, F., Fernandes, G. R., Varani,
A. M., Oliveira, G., and Pylro, V. S.: Genomic signatures and co-occurrence
patterns of the ultra-small Saccharimonadia (phylum CPR/Patescibacteria)
suggest a symbiotic lifestyle, Mol. Ecol., 28, 4259–4271,
<a href="https://doi.org/10.1111/mec.15208" target="_blank">https://doi.org/10.1111/mec.15208</a>, 2019.

    </mixed-citation></ref-html>
<ref-html id="bib1.bib70"><label>70</label><mixed-citation>
      
Leray, M., Yang, J. Y., Meyer, C. P., Mills, S. C., Agudelo, N., Ranwez, V.,
Boehm, J. T., and Machida, R. J.: A new versatile primer set targeting a
short fragment of the mitochondrial COI region for metabarcoding metazoan
diversity: Application for characterizing coral reef fish gut contents,
Front. Zool., 10, 1–14, <a href="https://doi.org/10.1186/1742-9994-10-34" target="_blank">https://doi.org/10.1186/1742-9994-10-34</a>, 2013.

    </mixed-citation></ref-html>
<ref-html id="bib1.bib71"><label>71</label><mixed-citation>
      
Limardo, A. J., Sudek, S., Choi, C. J., Poirier, C., Rii, Y. M., Blum, M.,
Roth, R., Goodenough, U., Church, M. J., and Worden, A. Z.: Quantitative
biogeography of picoprasinophytes establishes ecotype distributions and
significant contributions to marine phytoplankton, Environ. Microbiol., 19,
3219–3234, <a href="https://doi.org/10.1111/1462-2920.13812" target="_blank">https://doi.org/10.1111/1462-2920.13812</a>, 2017.

    </mixed-citation></ref-html>
<ref-html id="bib1.bib72"><label>72</label><mixed-citation>
      
Lin, S., Zhang, H., Hou, Y., Zhuang, Y., and Miranda, L.: High-level
diversity of dinoflagellates in the natural environment, revealed by
assessment of mitochondrial cox1 and cob genes for dinoflagellate DNA
barcoding, Appl. Environ. Microbiol., 75, 1279–1290,
<a href="https://doi.org/10.1128/AEM.01578-08" target="_blank">https://doi.org/10.1128/AEM.01578-08</a>, 2009.

    </mixed-citation></ref-html>
<ref-html id="bib1.bib73"><label>73</label><mixed-citation>
      
Marcy, Y., Ouverney, C., Bik, E. M., Lösekann, T., Ivanova, N., Martin,
H. G., Szeto, E., Platt, D., Hugenholtz, P., Relman, D. A., and Quake, S.
R.: Dissecting biological “dark matter” with single-cell genetic analysis
of rare and uncultivated TM7 microbes from the human mouth, P. Natl.
Acad. Sci. USA, 104, 11889–11894,
<a href="https://doi.org/10.1073/pnas.0704662104" target="_blank">https://doi.org/10.1073/pnas.0704662104</a>, 2007.

    </mixed-citation></ref-html>
<ref-html id="bib1.bib74"><label>74</label><mixed-citation>
      
Margalef, R.: Life-forms of phytoplankton as survival alternatives in an
unstable environment, Ocean. Acta, 1, 493–509, 1978.

    </mixed-citation></ref-html>
<ref-html id="bib1.bib75"><label>75</label><mixed-citation>
      
Martin, J. L., Santi, I., Pitta, P., John, U., and Gypens, N.: Towards
quantitative metabarcoding of eukaryotic plankton: an approach to improve
18S rRNA gene copy number bias, Metabarcod. Metagenom., 6, 245–259,
<a href="https://doi.org/10.3897/mbmg.6.85794" target="_blank">https://doi.org/10.3897/mbmg.6.85794</a>, 2022.

    </mixed-citation></ref-html>
<ref-html id="bib1.bib76"><label>76</label><mixed-citation>
      
Martin, M.: Cutadapt removes adapter sequences from high-throughput
sequencing reads, EMBnet J., 17, 10–12,
<a href="https://doi.org/10.14806/ej.17.1.200" target="_blank">https://doi.org/10.14806/ej.17.1.200</a>, 2011.

    </mixed-citation></ref-html>
<ref-html id="bib1.bib77"><label>77</label><mixed-citation>
      
Martino, C., Morton, J. T., Marotz, C. A., Thompson, L. R., Tripathi, A.,
Knight, R., and Zengler, K.: A Novel Sparse Compositional Technique Reveals
Microbial Perturbations, MSystems, 4, e00016-19,
<a href="https://doi.org/10.1128/msystems.00016-19" target="_blank">https://doi.org/10.1128/msystems.00016-19</a>, 2019.

    </mixed-citation></ref-html>
<ref-html id="bib1.bib78"><label>78</label><mixed-citation>
      
Matsuyama, Y., Miyamoto, M., and Kotani, Y.: Grazing impacts of the
heterotrophic dinoflagellate Polykrikos kofoidii on a bloom of Gymnodinium
catenatum, Aquat. Microb. Ecol., 17, 91–98,
<a href="https://doi.org/10.3354/ame017091" target="_blank">https://doi.org/10.3354/ame017091</a>, 1999.

    </mixed-citation></ref-html>
<ref-html id="bib1.bib79"><label>79</label><mixed-citation>
      
Messié, M. and Chavez, F. P.: Seasonal regulation of primary production
in eastern boundary upwelling systems, Prog. Oceanogr., 134, 1–18,
<a href="https://doi.org/10.1016/j.pocean.2014.10.011" target="_blank">https://doi.org/10.1016/j.pocean.2014.10.011</a>, 2015.

    </mixed-citation></ref-html>
<ref-html id="bib1.bib80"><label>80</label><mixed-citation>
      
Min, M. and Pitz, K.: MBARI-BOG/KOSMOS_eDNA_paper: Initial submission to Biogeosciences (v1.0), Zenodo [code and data set],
<a href="https://doi.org/10.5281/zenodo.7255826" target="_blank">https://doi.org/10.5281/zenodo.7255826</a>, 2022.

    </mixed-citation></ref-html>
<ref-html id="bib1.bib81"><label>81</label><mixed-citation>
      
Miya, M., Sato, Y., Fukunaga, T., Sado, T., Poulsen, J.Y., Sato, K., Minamoto, T., Yamamoto, S., Yamanaka, H., Araki, H., and Kondoh, M.: MiFish, a set of universal PCR primers for metabarcoding environmental DNA from fishes: detection of more than 230 subtropical marine species, Roy. Soc. Open Sci., 2,  150088, <a href="https://doi.org/10.1098/rsos.150088" target="_blank">https://doi.org/10.1098/rsos.150088</a>, 2015.

    </mixed-citation></ref-html>
<ref-html id="bib1.bib82"><label>82</label><mixed-citation>
      
Monuki, K., Barber, P. H., and Gold, Z.: eDNA captures depth partitioning in
a kelp forest ecosystem, PLoS One, 16, 1–17,
<a href="https://doi.org/10.1371/journal.pone.0253104" target="_blank">https://doi.org/10.1371/journal.pone.0253104</a>, 2021.

    </mixed-citation></ref-html>
<ref-html id="bib1.bib83"><label>83</label><mixed-citation>
      
Morris, A. W. and Riley, J. P.: The determination of nitrate in sea water,
Anal. Chim. Acta, 29, 272–279,
<a href="https://doi.org/10.1016/S0003-2670(00)88614-6" target="_blank">https://doi.org/10.1016/S0003-2670(00)88614-6</a>, 1963.

    </mixed-citation></ref-html>
<ref-html id="bib1.bib84"><label>84</label><mixed-citation>
      
Morris, R. M., Rappé, M. S., Connon, S. A., Vergin, K. L., Siebold, W.
A., Carlson, C. A., and Giovannoni, S. J.: SAR11 clade dominates ocean
surface bacterioplankton communities, Nature, 420, 806–810,
<a href="https://doi.org/10.1038/nature01240" target="_blank">https://doi.org/10.1038/nature01240</a>, 2002.

    </mixed-citation></ref-html>
<ref-html id="bib1.bib85"><label>85</label><mixed-citation>
      
Mullin, J. B. and Riley, J. P.: The colorimetric determination of silicate
with special reference to sea and natural waters, Anal. Chim. Acta, 12,
162–176, <a href="https://doi.org/10.1016/S0003-2670(00)87825-3" target="_blank">https://doi.org/10.1016/S0003-2670(00)87825-3</a>, 1955.

    </mixed-citation></ref-html>
<ref-html id="bib1.bib86"><label>86</label><mixed-citation>
      
Needham, D. M. and Fuhrman, J. A.: Pronounced daily succession of
phytoplankton, archaea and bacteria following a spring bloom, Nat.
Microbiol., 1, 16005, <a href="https://doi.org/10.1038/nmicrobiol.2016.5" target="_blank">https://doi.org/10.1038/nmicrobiol.2016.5</a>, 2016.

    </mixed-citation></ref-html>
<ref-html id="bib1.bib87"><label>87</label><mixed-citation>
      
Neufeld, J. D., Schäfer, H., Cox, M. J., Boden, R., McDonald, I. R., and
Murrell, J. C.: Stable-isotope probing implicates Methylophaga spp and novel
Gammaproteobacteria in marine methanol and methylamine metabolism, ISME J.,
1, 480–491, <a href="https://doi.org/10.1038/ismej.2007.65" target="_blank">https://doi.org/10.1038/ismej.2007.65</a>, 2007.

    </mixed-citation></ref-html>
<ref-html id="bib1.bib88"><label>88</label><mixed-citation>
      
O'donnell, J. L., Kelly, R. P., Lowell, N. C., and Port, J. A.: Indexed PCR
primers induce template- Specific bias in Large-Scale DNA sequencing
studies, PLoS One, 11, 1–11, <a href="https://doi.org/10.1371/journal.pone.0148698" target="_blank">https://doi.org/10.1371/journal.pone.0148698</a>,
2016.

    </mixed-citation></ref-html>
<ref-html id="bib1.bib89"><label>89</label><mixed-citation>
      
Ohki, K., Yamada, K., Kamiya, M., and Yoshikawa, S.: Morphological,
phylogenetic and physiological studies of pico-cyanobacteria isolated from
the halocline of a saline Meromictic Lake, Lake Suigetsu, Japan, Microbes
Environ., 27, 171–178, <a href="https://doi.org/10.1264/jsme2.ME11329" target="_blank">https://doi.org/10.1264/jsme2.ME11329</a>, 2012.

    </mixed-citation></ref-html>
<ref-html id="bib1.bib90"><label>90</label><mixed-citation>
      
Page, F. C.: Marine gymnamoebae, Institute of Terrestrial Ecology, 60 pp.,  1983.

    </mixed-citation></ref-html>
<ref-html id="bib1.bib91"><label>91</label><mixed-citation>
      
Parada, A. E., Needham, D. M., and Fuhrman, J. A.: Every base matters:
Assessing small subunit rRNA primers for marine microbiomes with mock
communities, time series and global field samples, Environ. Microbiol., 18,
1403–1414, <a href="https://doi.org/10.1111/1462-2920.13023" target="_blank">https://doi.org/10.1111/1462-2920.13023</a>, 2016.

    </mixed-citation></ref-html>
<ref-html id="bib1.bib92"><label>92</label><mixed-citation>
      
Park, M. G. and Kim, M.: Prey specificity and feeding of the thecate
mixotrophic dinoflagellate fragilidium duplocampanaeforme, J. Phycol., 46,
424–432, <a href="https://doi.org/10.1111/j.1529-8817.2010.00824.x" target="_blank">https://doi.org/10.1111/j.1529-8817.2010.00824.x</a>, 2010.

    </mixed-citation></ref-html>
<ref-html id="bib1.bib93"><label>93</label><mixed-citation>
      
Park, S., Jung, Y. T., Park, J. M., and Yoon, J. H.: <i>Pseudohongiella
acticola</i> sp. nov., a novel gammaproteobacterium isolated from seawater, and
emended description of the genus Pseudohongiella, Antonie van Leeuwenhoek,
Int. J. Gen. Mol. Microbiol., 106, 809–815,
<a href="https://doi.org/10.1007/s10482-014-0250-0" target="_blank">https://doi.org/10.1007/s10482-014-0250-0</a>, 2014.

    </mixed-citation></ref-html>
<ref-html id="bib1.bib94"><label>94</label><mixed-citation>
      
Parks, D. H., Chuvochina, M., Waite, D. W., Rinke, C., Skarshewski, A.,
Chaumeil, P. A., and Hugenholtz, P.: A standardized bacterial taxonomy based
on genome phylogeny substantially revises the tree of life, Nat.
Biotechnol., 36,  996–1004, <a href="https://doi.org/10.1038/nbt.4229" target="_blank">https://doi.org/10.1038/nbt.4229</a>, 2018.

    </mixed-citation></ref-html>
<ref-html id="bib1.bib95"><label>95</label><mixed-citation>
      
Partensky, F., Blanchot, J., and Vaulot, D.: Differential distribution and
ecology of Prochlorococcus and Synechococcus in oceanic waters: A review,
Bull. Inst. Ocean., 19, 457–475, 1999.

    </mixed-citation></ref-html>
<ref-html id="bib1.bib96"><label>96</label><mixed-citation>
      
Patterson, D., Nygaard, K., Steinberg, G., and Turley, C.: Heterotrophic
flagellates and other protists associated with oceanic detritus throughout
the water column in the mid north atlantic, J. Mar. Biol. Assoc. United
Kingdom, 73, 67–95, <a href="https://doi.org/10.1017/S0025315400032653" target="_blank">https://doi.org/10.1017/S0025315400032653</a>, 1993.

    </mixed-citation></ref-html>
<ref-html id="bib1.bib97"><label>97</label><mixed-citation>
      
Patti, B., Guisande, C., Vergara, A. R., Riveiro, I., Maneiro, I., Barreiro,
A., Bonanno, A., Buscaino, G., Cuttitta, A., Basilone, G., and Mazzola, S.:
Factors responsible for the differences in satellite-based chlorophyll a
concentration between the major global upwelling areas, Estuar. Coast. Shelf
Sci., 76, 775–786, <a href="https://doi.org/10.1016/j.ecss.2007.08.005" target="_blank">https://doi.org/10.1016/j.ecss.2007.08.005</a>, 2008.

    </mixed-citation></ref-html>
<ref-html id="bib1.bib98"><label>98</label><mixed-citation>
      
Pennington, J. T., Mahoney, K. L., Kuwahara, V. S., Kolber, D. D., Calienes,
R., and Chavez, F. P.: Primary production in the eastern tropical Pacific: A
review, Prog. Oceanogr., 69, 285–317,
<a href="https://doi.org/10.1016/j.pocean.2006.03.012" target="_blank">https://doi.org/10.1016/j.pocean.2006.03.012</a>, 2006.

    </mixed-citation></ref-html>
<ref-html id="bib1.bib99"><label>99</label><mixed-citation>
      
Penven, P., Echevin, V., Pasapera, J., Colas, F., and Tam, J.: Average
circulation, seasonal cycle, and mesoscale dynamics of the Peru Current
System: A modeling approach, J. Geophys. Res. C, 110, 1–21,
<a href="https://doi.org/10.1029/2005JC002945" target="_blank">https://doi.org/10.1029/2005JC002945</a>, 2005.

    </mixed-citation></ref-html>
<ref-html id="bib1.bib100"><label>100</label><mixed-citation>
      
Pitz, K., Truelove, N., Nye, C., Michisaki, R. P., and Chavez, F.: Environmental DNA (eDNA) 12S Metabarcoding Illumina MiSeq NGS PCR Protocol (Touchdown), protocols.io,
<a href="https://doi.org/10.17504/protocols.io.bcppivmn" target="_blank">https://doi.org/10.17504/protocols.io.bcppivmn</a>, 2020.

    </mixed-citation></ref-html>
<ref-html id="bib1.bib101"><label>101</label><mixed-citation>
      
Quast, C., Pruesse, E., Yilmaz, P., Gerken, J., Schweer, T., Yarza, P.,
Peplies, J., and Glöckner, F. O.: The SILVA ribosomal RNA gene database
project: Improved data processing and web-based tools, Nucl. Acids Res.,
41, 590–596, <a href="https://doi.org/10.1093/nar/gks1219" target="_blank">https://doi.org/10.1093/nar/gks1219</a>, 2013.

    </mixed-citation></ref-html>
<ref-html id="bib1.bib102"><label>102</label><mixed-citation>
      
R Core Team: R: A Language and Environment for Statistical Computing,
Vienna, Austria, <a href="http://www.R-project.org" target="_blank"/> (last access: 21 February 2023), 2019.

    </mixed-citation></ref-html>
<ref-html id="bib1.bib103"><label>103</label><mixed-citation>
      
Riebesell, U., Bellerby, R. G. J., Grossart, H. P., and Thingstad, F.:
Mesocosm CO<sub>2</sub> perturbation studies: From organism to community level,
Biogeosciences, 5, 1157–1164, <a href="https://doi.org/10.5194/bg-5-1157-2008" target="_blank">https://doi.org/10.5194/bg-5-1157-2008</a>, 2008.

    </mixed-citation></ref-html>
<ref-html id="bib1.bib104"><label>104</label><mixed-citation>
      
Riebesell, U., Czerny, J., Von Bröckel, K., Boxhammer, T.,
Büdenbender, J., Deckelnick, M., Fischer, M., Hoffmann, D., Krug, S. A.,
Lentz, U., Ludwig, A., Muche, R., and Schulz, K. G.: Technical Note: A
mobile sea-going mesocosm system – New opportunities for ocean change
research, Biogeosciences, 10, 1835–1847,
<a href="https://doi.org/10.5194/bg-10-1835-2013" target="_blank">https://doi.org/10.5194/bg-10-1835-2013</a>, 2013.

    </mixed-citation></ref-html>
<ref-html id="bib1.bib105"><label>105</label><mixed-citation>
      
Riemann, L., Steward, G. F., and Azam, F.: Erratum: Dynamics of bacterial
community composition and activity during a mesocosm diatom bloom,  Appl. Environ.
Microbiol., 66, 2282, <a href="https://doi.org/10.1128/AEM.66.5.2282-2282.2000" target="_blank">https://doi.org/10.1128/AEM.66.5.2282-2282.2000</a>, 2000.

    </mixed-citation></ref-html>
<ref-html id="bib1.bib106"><label>106</label><mixed-citation>
      
Rimet, F., Chaumeil, P., Keck, F., Kermarrec, L., Vasselon, V., Kahlert, M.,
Franc, A., and Bouchez, A.: R-Syst::diatom: An open-access and curated
barcode database for diatoms and freshwater monitoring, Database,
1–21, <a href="https://doi.org/10.1093/database/baw016" target="_blank">https://doi.org/10.1093/database/baw016</a>, 2016.

    </mixed-citation></ref-html>
<ref-html id="bib1.bib107"><label>107</label><mixed-citation>
      
Robertson, D. A.: Possible functions of surface structure and size in some
planktonic eggs of marine fishes, New Zeal. J. Mar. Freshw. Res., 15,
147–153, 1981.

    </mixed-citation></ref-html>
<ref-html id="bib1.bib108"><label>108</label><mixed-citation>
      
Sandaa, R. A., Gómez-Consarnau, L., Pinhassi, J., Riemann, L., Malits,
A., Weinbauer, M. G., Gasol, J. M., and Thingstad, T. F.: Viral control of
bacterial biodiversity – Evidence from a nutrient-enriched marine mesocosm
experiment, Environ. Microbiol., 11, 2585–2597,
<a href="https://doi.org/10.1111/j.1462-2920.2009.01983.x" target="_blank">https://doi.org/10.1111/j.1462-2920.2009.01983.x</a>, 2009.

    </mixed-citation></ref-html>
<ref-html id="bib1.bib109"><label>109</label><mixed-citation>
      
Sassoubre, L. M., Yamahara, K. M., Gardner, L. D., Block, B. A., and Boehm,
A. B.: Quantification of Environmental DNA (eDNA) Shedding and Decay Rates
for Three Marine Fish, Environ. Sci. Technol., 50, 10456–10464,
<a href="https://doi.org/10.1021/acs.est.6b03114" target="_blank">https://doi.org/10.1021/acs.est.6b03114</a>, 2016.

    </mixed-citation></ref-html>
<ref-html id="bib1.bib110"><label>110</label><mixed-citation>
      
Schnell, I. B., Bohmann, K., and Gilbert, M. T. P.: Tag jumps illuminated –
reducing sequence-to-sample misidentifications in metabarcoding studies,
Mol. Ecol. Resour., 15, 1289–1303, <a href="https://doi.org/10.1111/1755-0998.12402" target="_blank">https://doi.org/10.1111/1755-0998.12402</a>,
2015.

    </mixed-citation></ref-html>
<ref-html id="bib1.bib111"><label>111</label><mixed-citation>
      
Schoenle, A., Hohlfeld, M., Rosse, M., Filz, P., Wylezich, C., Nitsche, F.,
and Arndt, H.: Global comparison of bicosoecid Cafeteria-like flagellates
from the deep ocean and surface waters, with reorganization of the family
Cafeteriaceae, Eur. J. Protistol., 73, 125665,
<a href="https://doi.org/10.1016/j.ejop.2019.125665" target="_blank">https://doi.org/10.1016/j.ejop.2019.125665</a>, 2020.

    </mixed-citation></ref-html>
<ref-html id="bib1.bib112"><label>112</label><mixed-citation>
      
Silva, A. and Oliva, M.: Revisión sobre aspectos biológicos y de
cultivo del lenguado chileno (Paralichthys adspersus), Lat. Am. J. Aquat.
Res., 38, 377–386, 2010.

    </mixed-citation></ref-html>
<ref-html id="bib1.bib113"><label>113</label><mixed-citation>
      
Simmons, M. P., Sudek, S., Monier, A., Limardo, A. J., Jimenez, V., Perle,
C. R., Elrod, V. A., Pennington, J. T., and Worden, A. Z.: Abundance and
biogeography of picoprasinophyte ecotypes and other phytoplankton in the
eastern North Pacific Ocean, Appl. Environ. Microbiol., 82, 1693–1705,
<a href="https://doi.org/10.1128/AEM.02730-15" target="_blank">https://doi.org/10.1128/AEM.02730-15</a>, 2016.

    </mixed-citation></ref-html>
<ref-html id="bib1.bib114"><label>114</label><mixed-citation>
      
Skjoldal, H. R., Wiebe, P. H., Postel, L., Knutsen, T., Kaartvedt, S., and
Sameoto, D. D.: Intercomparison of zooplankton (net) sampling systems:
Results from the ICES/GLOBEC sea-going workshop, Prog. Oceanogr., 108,
1–42, <a href="https://doi.org/10.1016/j.pocean.2012.10.006" target="_blank">https://doi.org/10.1016/j.pocean.2012.10.006</a>, 2013.

    </mixed-citation></ref-html>
<ref-html id="bib1.bib115"><label>115</label><mixed-citation>
      
Smayda, T. J.: Adaptations and selection of harmful and other dinoflagellate
species in upwelling systems. 2. Motility and migratory behaviour, Prog.
Oceanogr., 85, 71–91, <a href="https://doi.org/10.1016/j.pocean.2010.02.005" target="_blank">https://doi.org/10.1016/j.pocean.2010.02.005</a>, 2010.

    </mixed-citation></ref-html>
<ref-html id="bib1.bib116"><label>116</label><mixed-citation>
      
Smayda, T. J. and Trainer, V. L.: Dinoflagellate blooms in upwelling
systems: Seeding, variability, and contrasts with diatom bloom behaviour,
Prog. Oceanogr., 85, 92–107, <a href="https://doi.org/10.1016/j.pocean.2010.02.006" target="_blank">https://doi.org/10.1016/j.pocean.2010.02.006</a>,
2010.

    </mixed-citation></ref-html>
<ref-html id="bib1.bib117"><label>117</label><mixed-citation>
      
Spear-bernstein, L. and Miller, K. R.: Unique Location of the
Phycobiliprotein Light-Harvesting Pigment in the Cryptophyceae, J. Phycol.,
25, 412–419, <a href="https://doi.org/10.1111/j.1529-8817.1989.tb00245.x" target="_blank">https://doi.org/10.1111/j.1529-8817.1989.tb00245.x</a>, 1989.

    </mixed-citation></ref-html>
<ref-html id="bib1.bib118"><label>118</label><mixed-citation>
      
Spilling, K., Olli, K., Lehtoranta, J., Kremp, A., Tedesco, L., Tamelander,
T., Klais, R., Peltonen, H., and Tamminen, T.: Shifting
diatom – dinoflagellate dominance during spring bloom in the Baltic Sea and
its potential effects on biogeochemical cycling, Front. Mar. Sci., 5, 327,
2018.

    </mixed-citation></ref-html>
<ref-html id="bib1.bib119"><label>119</label><mixed-citation>
      
Stewart, R. I. A., Dossena, M., Bohan, D. A., Jeppesen, E., Kordas, R. L.,
Ledger, M. E., Meerhoff, M., Moss, B., Mulder, C., Shurin, J. B., Suttle,
B., Thompson, R., Trimmer, M., and Woodward, G.: Mesocosm Experiments as a
Tool for Ecological Climate-Change Research, 1st Edn., Elsevier Ltd., 71–181, <a href="https://doi.org/10.1016/B978-0-12-417199-2.00002-1" target="_blank">https://doi.org/10.1016/B978-0-12-417199-2.00002-1</a>, 2013.

    </mixed-citation></ref-html>
<ref-html id="bib1.bib120"><label>120</label><mixed-citation>
      
Stoeck, T., Bass, D., Nebel, M., Christen, R., Jones, M. D. M., Breiner, H.
W., and Richards, T. A.: Multiple marker parallel tag environmental DNA
sequencing reveals a highly complex eukaryotic community in marine anoxic
water, Mol. Ecol., 19, 21–31,
<a href="https://doi.org/10.1111/j.1365-294X.2009.04480.x" target="_blank">https://doi.org/10.1111/j.1365-294X.2009.04480.x</a>, 2010.

    </mixed-citation></ref-html>
<ref-html id="bib1.bib121"><label>121</label><mixed-citation>
      
Sudek, S., Everroad, R. C., Gehman, A. L. M., Smith, J. M., Poirier, C. L.,
Chavez, F. P., and Worden, A. Z.: Cyanobacterial distributions along a
physico-chemical gradient in the Northeastern Pacific Ocean, Environ.
Microbiol., 17, 3692–3707, <a href="https://doi.org/10.1111/1462-2920.12742" target="_blank">https://doi.org/10.1111/1462-2920.12742</a>, 2015.

    </mixed-citation></ref-html>
<ref-html id="bib1.bib122"><label>122</label><mixed-citation>
      
Suffrian, K., Simonelli, P., Nejstgaard, J. C., Putzeys, S., Carotenuto, Y.,
and Antia, A. N.: Microzooplankton grazing and phytoplankton growth in
marine mesocosms with increased CO<sub>2</sub> levels, Biogeosciences, 5, 1145–1156,
<a href="https://doi.org/10.5194/bg-5-1145-2008" target="_blank">https://doi.org/10.5194/bg-5-1145-2008</a>, 2008.

    </mixed-citation></ref-html>
<ref-html id="bib1.bib123"><label>123</label><mixed-citation>
      
Taberlet, P., Coissac, E., Hajibabaei, M., and Rieseberg, L.: Environmental
DNA, Mol. Ecol., 21, 1789–1793, 2012.

    </mixed-citation></ref-html>
<ref-html id="bib1.bib124"><label>124</label><mixed-citation>
      
Taucher, J., Bach, L. T., Boxhammer, T., Nauendorf, A., Achterberg, E. P.,
Algueró-Muñiz, M., Arístegui, J., Czerny, J., Esposito, M.,
Guan, W., Haunost, M., Horn, H. G., Ludwig, A., Meyer, J., Spisla, C.,
Sswat, M., Stange, P., Riebesell, U., Aberle-Malzahn, N., Archer, S.,
Boersma, M., Broda, N., Büdenbender, J., Clemmesen, C., Deckelnick, M.,
Dittmar, T., Dolores-Gelado, M., Dörner, I., Fernández-Urruzola, I.,
Fiedler, M., Fischer, M., Fritsche, P., Gomez, M., Grossart, H. P., Hattich,
G., Hernández-Brito, J., Hernández-Hernández, N.,
Hernández-León, S., Hornick, T., Kolzenburg, R., Krebs, L.,
Kreuzburg, M., Lange, J. A. F., Lischka, S., Linsenbarth, S.,&thinsp;Löscher,
C., Martínez, I., Montoto, T., Nachtigall, K., Osma-Prado, N., Packard,
T., Pansch, C., Posman, K., Ramírez-Bordón, B., Romero-Kutzner, V.,
Rummel, C., Salta, M., Martínez-Sánchez, I., Schröder, H.,
Sett, S., Singh, A., Suffrian, K., Tames-Espinosa, M., Voss, M., Walter, E.,
Wannicke, N., Xu, J., and Zark, M.: Influence of ocean acidification and
deep water upwelling on oligotrophic plankton communities in the subtropical
North Atlantic: Insights from an in situ mesocosm study, Front. Mar. Sci.,
4, 85, <a href="https://doi.org/10.3389/fmars.2017.00085" target="_blank">https://doi.org/10.3389/fmars.2017.00085</a>, 2017.

    </mixed-citation></ref-html>
<ref-html id="bib1.bib125"><label>125</label><mixed-citation>
      
Tillmann, U.: Interactions between planktonic microalgae and protozoan
grazers, J. Eukaryot. Microbiol., 51, 156–168,
<a href="https://doi.org/10.1111/j.1550-7408.2004.tb00540.x" target="_blank">https://doi.org/10.1111/j.1550-7408.2004.tb00540.x</a>, 2004.

    </mixed-citation></ref-html>
<ref-html id="bib1.bib126"><label>126</label><mixed-citation>
      
Trainer, V. L., Pitcher, G. C., Reguera, B., and Smayda, T. J.: The
distribution and impacts of harmful algal bloom species in eastern boundary
upwelling systems, Prog. Oceanogr., 85, 33–52,
<a href="https://doi.org/10.1016/j.pocean.2010.02.003" target="_blank">https://doi.org/10.1016/j.pocean.2010.02.003</a>, 2010.

    </mixed-citation></ref-html>
<ref-html id="bib1.bib127"><label>127</label><mixed-citation>
      
Tyrrell, T. and Merico, A.: Emiliania huxleyi: bloom observations and the
conditions that induce them, in: Coccolithophores, Springer Berlin,
Heidelberg,  75–97, <a href="https://doi.org/10.1007/978-3-662-06278-4_4" target="_blank">https://doi.org/10.1007/978-3-662-06278-4_4</a>, 2004.

    </mixed-citation></ref-html>
<ref-html id="bib1.bib128"><label>128</label><mixed-citation>
      
Ushio, M., Murata, K., Sado, T., Nishiumi, I., Takeshita, M., Iwasaki, W.,
and Miya, M.: Demonstration of the potential of environmental DNA as a tool
for the detection of avian species, Sci. Rep., 8, 1–10,
<a href="https://doi.org/10.1038/s41598-018-22817-5" target="_blank">https://doi.org/10.1038/s41598-018-22817-5</a>, 2018.

    </mixed-citation></ref-html>
<ref-html id="bib1.bib129"><label>129</label><mixed-citation>
      
Valentini, A., Taberlet, P., Miaud, C., Civade, R., Herder, J., Thomsen, P.
F., Bellemain, E., Besnard, A., Coissac, E., Boyer, F., Gaboriaud, C., Jean,
P., Poulet, N., Roset, N., Copp, G. H., Geniez, P., Pont, D., Argillier, C.,
Baudoin, J. M., Peroux, T., Crivelli, A. J., Olivier, A., Acqueberge, M., Le
Brun, M., Møller, P. R., Willerslev, E., and Dejean, T.: Next-generation
monitoring of aquatic biodiversity using environmental DNA metabarcoding,
Mol. Ecol., 25, 929–942, <a href="https://doi.org/10.1111/mec.13428" target="_blank">https://doi.org/10.1111/mec.13428</a>, 2016.

    </mixed-citation></ref-html>
<ref-html id="bib1.bib130"><label>130</label><mixed-citation>
      
Vincent, F. J., Colin, S., Romac, S., Scalco, E., Bittner, L., Garcia, Y.,
Lopes, R. M., Dolan, J. R., Zingone, A., and De Vargas, C.: The epibiotic
life of the cosmopolitan diatom Fragilariopsis doliolus on heterotrophic
ciliates in the open ocean, ISME J., 12, 1094–1108, 2018.

    </mixed-citation></ref-html>
<ref-html id="bib1.bib131"><label>131</label><mixed-citation>
      
Walz, K., Yamahara, K., Michisaki, R. P., and Chavez, F. P.:   MBARI Environmental DNA (eDNA) extraction using Qiagen DNeasy Blood and Tissue Kit, protocols.io,
<a href="https://doi.org/10.17504/protocols.io.xjufknw" target="_blank">https://doi.org/10.17504/protocols.io.xjufknw</a>, 2019.

    </mixed-citation></ref-html>
<ref-html id="bib1.bib132"><label>132</label><mixed-citation>
      
Wear, E. K., Wilbanks, E. G., Nelson, C. E., and Carlson, C. A.: Primer
selection impacts specific population abundances but not community dynamics
in a monthly time-series 16S rRNA gene amplicon analysis of coastal marine
bacterioplankton, Environ. Microbiol., 20, 2709–2726,
<a href="https://doi.org/10.1111/1462-2920.14091" target="_blank">https://doi.org/10.1111/1462-2920.14091</a>, 2018.

    </mixed-citation></ref-html>
<ref-html id="bib1.bib133"><label>133</label><mixed-citation>
      
Wiebe, P. H. and Holland, W. R.: Plankton Patchiness: Effects on Repeated
Net Tows, Limnol. Oceanogr., 13, 315–321,
<a href="https://doi.org/10.4319/lo.1968.13.2.0315" target="_blank">https://doi.org/10.4319/lo.1968.13.2.0315</a>, 1968.

    </mixed-citation></ref-html>
<ref-html id="bib1.bib134"><label>134</label><mixed-citation>
      
Worden, A. Z., Nolan, J. K., and Palenik, B.: Assessing the dynamics and
ecology of marine picophytoplankton: The importance of the eukaryotic
component, Limnol. Oceanogr., 49, 168–179,
<a href="https://doi.org/10.4319/lo.2004.49.1.0168" target="_blank">https://doi.org/10.4319/lo.2004.49.1.0168</a>, 2004.

    </mixed-citation></ref-html>
<ref-html id="bib1.bib135"><label>135</label><mixed-citation>
      
Xu, L., Wu, Y. H., Jian, S. L., Wang, C. S., Wu, M., Cheng, L., and Xu, X.
W.: Pseudohongiella nitratireducens sp. Nov., isolated from seawater, and
emended description of the genus Pseudohongiella, Int. J. Syst. Evol.
Microbiol., 66, 5155–5160, <a href="https://doi.org/10.1099/ijsem.0.001489" target="_blank">https://doi.org/10.1099/ijsem.0.001489</a>, 2016.

    </mixed-citation></ref-html>
<ref-html id="bib1.bib136"><label>136</label><mixed-citation>
      
Yang, C., Li, Y., Zhou, Y., Zheng, W., Tian, Y., and Zheng, T.: Bacterial
community dynamics during a bloom caused by Akashiwo sanguinea in the Xiamen
sea area, China, Harmful Algae, 20, 132–141,
<a href="https://doi.org/10.1016/j.hal.2012.09.002" target="_blank">https://doi.org/10.1016/j.hal.2012.09.002</a>, 2012.

    </mixed-citation></ref-html>
<ref-html id="bib1.bib137"><label>137</label><mixed-citation>
      
Yang, C., Li, Y., Zhou, B., Zhou, Y., Zheng, W., Tian, Y., Van Nostrand, J.
D., Wu, L., He, Z., Zhou, J., and Zheng, T.: Illumina sequencing-based
analysis of free-living bacterial community dynamics during an Akashiwo
sanguine bloom in Xiamen sea, China, Sci. Rep., 5, 1–11,
<a href="https://doi.org/10.1038/srep08476" target="_blank">https://doi.org/10.1038/srep08476</a>, 2015.


    </mixed-citation></ref-html>
<ref-html id="bib1.bib138"><label>138</label><mixed-citation>
      
Zubkov, M. V.: Faster growth of the major prokaryotic versus eukaryotic CO<sub>2</sub>
fixers in the oligotrophic ocean, Nat. Commun., 5, 1–6,
<a href="https://doi.org/10.1038/ncomms4776" target="_blank">https://doi.org/10.1038/ncomms4776</a>, 2014.

    </mixed-citation></ref-html>--></article>
